Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227598338:

Variant ID: vg0227598338 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27598338
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTATCAAAATATATTCAATGTTAGATTTAATGAAACTAATTTGATATTTTAGATATTGCTAAATTTTTCTATAAACTTGATCAAACTTAATAAAGTTT[G/A]
AATAGAAAAAAAGTCAAACGACTTATAATATATATATTATTTAAACGGAGGGAGGAGTAGTATTTGTAGCTGGCAGAGGAAGAACTACGAACAGAAGAGA

Reverse complement sequence

TCTCTTCTGTTCGTAGTTCTTCCTCTGCCAGCTACAAATACTACTCCTCCCTCCGTTTAAATAATATATATATTATAAGTCGTTTGACTTTTTTTCTATT[C/T]
AAACTTTATTAAGTTTGATCAAGTTTATAGAAAAATTTAGCAATATCTAAAATATCAAATTAGTTTCATTAAATCTAACATTGAATATATTTTGATAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	5.10%	1.57%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.11%	0.00%	NA
All Japonica	1512	79.80%	15.70%	4.56%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	92.60%	1.20%	6.26%	0.00%	NA
Tropical Japonica	504	68.10%	30.00%	1.98%	0.00%	NA
Japonica Intermediate	241	63.50%	32.00%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227598338	G -> A	LOC_Os02g45390.1	upstream_gene_variant ; 3982.0bp to feature; MODIFIER	silent_mutation	Average:48.233; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0227598338	G -> A	LOC_Os02g45380-LOC_Os02g45390	intergenic_region ; MODIFIER	silent_mutation	Average:48.233; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227598338	4.38E-06	1.49E-06	mr1838_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251