\
| Variant ID: vg0227578016 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27578016 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 45. )
TCCCAAACCTCCTCATACCACGGAGGGGTGATACCCGCAGGTACACATGATCTCCTTTTTCAAACTCAAGGTCACGCCTCCGATTGTCAGCGTAATTCTT[T/C]
TGACGGTTCTGCGTTGTCTTTAAACGTTCTCGGATTAGCTTAACTTGTTCTTCTGCTGCCTTGAGTATGTCAGGACCGAATACTAGCGCTTCGCCCACCT
AGGTGGGCGAAGCGCTAGTATTCGGTCCTGACATACTCAAGGCAGCAGAAGAACAAGTTAAGCTAATCCGAGAACGTTTAAAGACAACGCAGAACCGTCA[A/G]
AAGAATTACGCTGACAATCGGAGGCGTGACCTTGAGTTTGAAAAAGGAGATCATGTGTACCTGCGGGTATCACCCCTCCGTGGTATGAGGAGGTTTGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 17.60% | 35.74% | 14.22% | NA |
| All Indica | 2759 | 5.50% | 19.60% | 51.18% | 23.67% | NA |
| All Japonica | 1512 | 79.70% | 8.10% | 11.97% | 0.20% | NA |
| Aus | 269 | 15.20% | 57.20% | 24.54% | 2.97% | NA |
| Indica I | 595 | 3.00% | 9.70% | 65.55% | 21.68% | NA |
| Indica II | 465 | 3.90% | 15.90% | 50.32% | 29.89% | NA |
| Indica III | 913 | 7.70% | 27.80% | 43.92% | 20.59% | NA |
| Indica Intermediate | 786 | 5.90% | 19.80% | 49.24% | 25.06% | NA |
| Temperate Japonica | 767 | 66.00% | 15.30% | 18.77% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 0.60% | 3.37% | 0.60% | NA |
| Japonica Intermediate | 241 | 90.50% | 1.20% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 13.30% | 31.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227578016 | T -> DEL | LOC_Os02g45370.1 | N | frameshift_variant | Average:8.261; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| vg0227578016 | T -> C | LOC_Os02g45370.1 | synonymous_variant ; p.Gln1452Gln; LOW | stop_gained | Average:8.261; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227578016 | 3.07E-06 | 3.07E-06 | mr1914 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 1.07E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 3.43E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 6.86E-06 | 4.94E-07 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 1.21E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 7.46E-07 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 4.08E-06 | NA | mr1371_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 8.40E-06 | 8.40E-06 | mr1371_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 9.70E-07 | 9.70E-07 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 2.18E-06 | 2.18E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 4.10E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 5.39E-06 | NA | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | 3.78E-06 | 3.78E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227578016 | NA | 5.10E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |