\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227043009:

Variant ID: vg0227043009 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 27043009
Reference Allele: GCGCAAlternative Allele: ACGCA,G
Primary Allele: GCGCASecondary Allele: ACGCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGTGATTAATTAAGTATTAGCTAACTTTTTTTTAAAAAAAATAACTTTTATATAGAAAATTTTTTAAAAAACACATCGTTTAGCCGTTTGAAAAGCAT[GCGCA/ACGCA,G]
TGGAATACTAGTAAGAGCGGTTGGGAGTCCTTTGCAACGAAAACAGCCTTAGTAGCAAGCACAAACTAACTCAGCTTTAGAGGCCCCTCATATTGATGTT

Reverse complement sequence

AACATCAATATGAGGGGCCTCTAAAGCTGAGTTAGTTTGTGCTTGCTACTAAGGCTGTTTTCGTTGCAAAGGACTCCCAACCGCTCTTACTAGTATTCCA[TGCGC/TGCGT,C]
ATGCTTTTCAAACGGCTAAACGATGTGTTTTTTAAAAAATTTTCTATATAAAAGTTATTTTTTTTAAAAAAAAGTTAGCTAATACTTAATTAATCACGCG

Allele Frequencies:

Populations Population SizeFrequency of GCGCA(primary allele) Frequency of ACGCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.30% 0.32% 0.00% G: 0.04%
All Indica  2759 92.30% 7.10% 0.51% 0.00% G: 0.07%
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.90% 6.70% 1.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 85.30% 14.20% 0.22% 0.00% G: 0.22%
Indica Intermediate  786 96.10% 3.40% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227043009 GCGCA -> G LOC_Os02g44630.1 upstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> G LOC_Os02g44630.3 upstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> G LOC_Os02g44630.2 upstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> G LOC_Os02g44620.1 downstream_gene_variant ; 2145.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> G LOC_Os02g44620-LOC_Os02g44630 intergenic_region ; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> ACGCA LOC_Os02g44630.1 upstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> ACGCA LOC_Os02g44630.3 upstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> ACGCA LOC_Os02g44630.2 upstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> ACGCA LOC_Os02g44620.1 downstream_gene_variant ; 2144.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N
vg0227043009 GCGCA -> ACGCA LOC_Os02g44620-LOC_Os02g44630 intergenic_region ; MODIFIER silent_mutation Average:71.314; most accessible tissue: Zhenshan97 flower, score: 96.209 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0227043009 GCGCA ACGCA -0.01 0.0 0.01 0.01 -0.02 -0.04
vg0227043009 GCGCA G 0.2 0.15 0.11 0.07 0.18 0.32

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227043009 NA 8.44E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0227043009 NA 3.46E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227043009 1.31E-06 6.36E-07 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227043009 NA 2.66E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227043009 NA 2.51E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227043009 NA 2.03E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227043009 NA 3.20E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251