\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226014296:

Variant ID: vg0226014296 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26014296
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTCGTAAGTACGCAGGCCATCTCGCGCGCGCAACTCGTGCGACGTTATTTTTTTAAAACAAAAGCAATTCTACGGTTCTTGAGGAGGTATCATGAGGT[A/G]
CCAAAATTTTGGTACCTCATGATACCTCATACTACCTAGGTACCATGAGGTACCAAATTTTCAATAGAAAAAATAGTATTTCATGGTACCTTCTAAAGGA

Reverse complement sequence

TCCTTTAGAAGGTACCATGAAATACTATTTTTTCTATTGAAAATTTGGTACCTCATGGTACCTAGGTAGTATGAGGTATCATGAGGTACCAAAATTTTGG[T/C]
ACCTCATGATACCTCCTCAAGAACCGTAGAATTGCTTTTGTTTTAAAAAAATAACGTCGCACGAGTTGCGCGCGCGAGATGGCCTGCGTACTTACGAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 2.80% 4.17% 43.74% NA
All Indica  2759 24.40% 2.70% 6.31% 66.55% NA
All Japonica  1512 97.80% 0.00% 0.07% 2.18% NA
Aus  269 7.80% 20.40% 7.43% 64.31% NA
Indica I  595 7.60% 0.00% 12.77% 79.66% NA
Indica II  465 38.10% 6.00% 3.01% 52.90% NA
Indica III  913 24.60% 3.00% 4.49% 67.91% NA
Indica Intermediate  786 28.90% 2.50% 5.47% 63.10% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 94.40% 0.00% 0.20% 5.36% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 71.10% 3.30% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226014296 A -> G LOC_Os02g43150-LOC_Os02g43160 intergenic_region ; MODIFIER silent_mutation Average:89.849; most accessible tissue: Callus, score: 98.594 N N N N
vg0226014296 A -> DEL N N silent_mutation Average:89.849; most accessible tissue: Callus, score: 98.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0226014296 A G 0.01 -0.02 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226014296 NA 1.68E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 3.57E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 2.73E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 3.25E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 1.53E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 7.49E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 7.25E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 8.47E-08 mr1564 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 4.00E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 2.26E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 1.13E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 8.87E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014296 NA 8.48E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251