\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225907297:

Variant ID: vg0225907297 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25907297
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTACTCGCACTACTGCCCAGAGCTAAGGAGAGGAGAGGGAGCGAGGAGGGAGAACGGGAGATGCACTACCGAGCCGAGACGGGCGCTGTGTCGAGCG[G/A]
CCGACGACGCGGGAGCGAGCTCTCCGGCCTCGGGCCAGGGAAGGGGAAGGAGACAGTGCCTGGAGTCCCGCGTCAGCTCCTCGCGCGCACGCCGGCTTCA

Reverse complement sequence

TGAAGCCGGCGTGCGCGCGAGGAGCTGACGCGGGACTCCAGGCACTGTCTCCTTCCCCTTCCCTGGCCCGAGGCCGGAGAGCTCGCTCCCGCGTCGTCGG[C/T]
CGCTCGACACAGCGCCCGTCTCGGCTCGGTAGTGCATCTCCCGTTCTCCCTCCTCGCTCCCTCTCCTCTCCTTAGCTCTGGGCAGTAGTGCGAGTAGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.80% 0.04% 0.00% NA
All Indica  2759 91.90% 8.00% 0.04% 0.00% NA
All Japonica  1512 2.50% 97.50% 0.00% 0.00% NA
Aus  269 68.40% 31.20% 0.37% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 94.20% 5.70% 0.11% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225907297 G -> A LOC_Os02g43030.1 downstream_gene_variant ; 2642.0bp to feature; MODIFIER silent_mutation Average:32.066; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg0225907297 G -> A LOC_Os02g43020-LOC_Os02g43030 intergenic_region ; MODIFIER silent_mutation Average:32.066; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225907297 NA 1.53E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 1.70E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 3.56E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 4.18E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 4.41E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 1.55E-06 6.19E-09 mr1508 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 1.14E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 2.37E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 1.03E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 9.17E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 3.22E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225907297 NA 7.36E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251