Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225541312:

Variant ID: vg0225541312 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25541312
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGAGAAATATAAAACATGACCAAAGAATTCATCGAGTGAATGGAGGATCTACAAGATATCAAAATTCAATGAGTTTTGGAATCCAGTTCGGCCTTCGG[A/G]
GACAGCACTGACTTCAAACGGACCTAGCGCCTTCATGCCAACTCCGATTTGGGTGATCTTAGACTTCGTGGAAAGCTTATCTCGTTACCTTTCAAACGCA

Reverse complement sequence

TGCGTTTGAAAGGTAACGAGATAAGCTTTCCACGAAGTCTAAGATCACCCAAATCGGAGTTGGCATGAAGGCGCTAGGTCCGTTTGAAGTCAGTGCTGTC[T/C]
CCGAAGGCCGAACTGGATTCCAAAACTCATTGAATTTTGATATCTTGTAGATCCTCCATTCACTCGATGAATTCTTTGGTCATGTTTTATATTTCTCATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	5.20%	0.47%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	83.70%	15.20%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.30%	0.39%	0.00%	NA
Tropical Japonica	504	59.10%	39.50%	1.39%	0.00%	NA
Japonica Intermediate	241	85.10%	12.00%	2.90%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	4.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225541312	A -> G	LOC_Os02g42460.1	upstream_gene_variant ; 2056.0bp to feature; MODIFIER	silent_mutation	Average:55.951; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0225541312	A -> G	LOC_Os02g42450.1	downstream_gene_variant ; 886.0bp to feature; MODIFIER	silent_mutation	Average:55.951; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0225541312	A -> G	LOC_Os02g42450-LOC_Os02g42460	intergenic_region ; MODIFIER	silent_mutation	Average:55.951; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225541312	1.36E-06	2.53E-10	mr1217	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	1.53E-06	mr1342	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	1.74E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	2.99E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	4.74E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	4.40E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	1.95E-06	1.25E-06	mr1638	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	1.30E-06	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	1.01E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	9.31E-06	mr1731	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	1.05E-06	8.14E-10	mr1845	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	NA	6.26E-06	mr1866	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225541312	1.27E-06	1.27E-06	mr1869	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251