\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225406731:

Variant ID: vg0225406731 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25406731
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGAGTATTCTACTTACAAATCATTGTAGCTAAGGGATCACATCAGCATTAGCTGTTTTATTACGGTACTCCCTCCATCCCAAAATATAAGCATTTCC[G/T,A]
GTTTTGTCCTAAGTCAAACTATCCTAAGTGTATATAAAAGTATTTACAGTATCAAATGAGCATCATTAGATTCATCATGAAATATATTTTCATAGTTTAC

Reverse complement sequence

GTAAACTATGAAAATATATTTCATGATGAATCTAATGATGCTCATTTGATACTGTAAATACTTTTATATACACTTAGGATAGTTTGACTTAGGACAAAAC[C/A,T]
GGAAATGCTTATATTTTGGGATGGAGGGAGTACCGTAATAAAACAGCTAATGCTGATGTGATCCCTTAGCTACAATGATTTGTAAGTAGAATACTCCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 24.30% 0.28% 0.21% A: 0.49%
All Indica  2759 60.20% 38.90% 0.40% 0.25% A: 0.25%
All Japonica  1512 95.00% 3.80% 0.07% 0.13% A: 0.99%
Aus  269 98.90% 0.70% 0.00% 0.00% A: 0.37%
Indica I  595 64.40% 35.00% 0.17% 0.50% NA
Indica II  465 68.60% 30.50% 0.65% 0.00% A: 0.22%
Indica III  913 54.80% 44.40% 0.44% 0.11% A: 0.33%
Indica Intermediate  786 58.30% 40.60% 0.38% 0.38% A: 0.38%
Temperate Japonica  767 99.50% 0.40% 0.00% 0.00% A: 0.13%
Tropical Japonica  504 87.30% 10.30% 0.20% 0.40% A: 1.79%
Japonica Intermediate  241 97.10% 0.80% 0.00% 0.00% A: 2.07%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225406731 G -> A LOC_Os02g42220.1 downstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> A LOC_Os02g42250.1 downstream_gene_variant ; 4778.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> A LOC_Os02g42230.1 intron_variant ; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> T LOC_Os02g42220.1 downstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> T LOC_Os02g42250.1 downstream_gene_variant ; 4778.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> T LOC_Os02g42230.1 intron_variant ; MODIFIER silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N
vg0225406731 G -> DEL N N silent_mutation Average:39.621; most accessible tissue: Callus, score: 72.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225406731 4.78E-07 NA mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 1.44E-06 2.67E-07 mr1069 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 3.09E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 2.00E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 5.43E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 8.95E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 7.91E-06 3.24E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 7.72E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 4.99E-06 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 5.42E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 2.37E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 9.56E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 1.90E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 9.00E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 2.26E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731 NA 1.16E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251