Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225406731:

Variant ID: vg0225406731 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25406731
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGGAGTATTCTACTTACAAATCATTGTAGCTAAGGGATCACATCAGCATTAGCTGTTTTATTACGGTACTCCCTCCATCCCAAAATATAAGCATTTCC[G/T,A]
GTTTTGTCCTAAGTCAAACTATCCTAAGTGTATATAAAAGTATTTACAGTATCAAATGAGCATCATTAGATTCATCATGAAATATATTTTCATAGTTTAC

Reverse complement sequence

GTAAACTATGAAAATATATTTCATGATGAATCTAATGATGCTCATTTGATACTGTAAATACTTTTATATACACTTAGGATAGTTTGACTTAGGACAAAAC[C/A,T]
GGAAATGCTTATATTTTGGGATGGAGGGAGTACCGTAATAAAACAGCTAATGCTGATGTGATCCCTTAGCTACAATGATTTGTAAGTAGAATACTCCTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	24.30%	0.28%	0.21%	A: 0.49%
All Indica	2759	60.20%	38.90%	0.40%	0.25%	A: 0.25%
All Japonica	1512	95.00%	3.80%	0.07%	0.13%	A: 0.99%
Aus	269	98.90%	0.70%	0.00%	0.00%	A: 0.37%
Indica I	595	64.40%	35.00%	0.17%	0.50%	NA
Indica II	465	68.60%	30.50%	0.65%	0.00%	A: 0.22%
Indica III	913	54.80%	44.40%	0.44%	0.11%	A: 0.33%
Indica Intermediate	786	58.30%	40.60%	0.38%	0.38%	A: 0.38%
Temperate Japonica	767	99.50%	0.40%	0.00%	0.00%	A: 0.13%
Tropical Japonica	504	87.30%	10.30%	0.20%	0.40%	A: 1.79%
Japonica Intermediate	241	97.10%	0.80%	0.00%	0.00%	A: 2.07%
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225406731	G -> A	LOC_Os02g42220.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> A	LOC_Os02g42250.1	downstream_gene_variant ; 4778.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> A	LOC_Os02g42230.1	intron_variant ; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> T	LOC_Os02g42220.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> T	LOC_Os02g42250.1	downstream_gene_variant ; 4778.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> T	LOC_Os02g42230.1	intron_variant ; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N
vg0225406731	G -> DEL	N	N	silent_mutation	Average:39.621; most accessible tissue: Callus, score: 72.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225406731	4.78E-07	NA	mr1069	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	1.44E-06	2.67E-07	mr1069	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	3.09E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	2.00E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	5.43E-08	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	8.95E-06	NA	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	7.91E-06	3.24E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	7.72E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	4.99E-06	NA	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	5.42E-06	NA	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	2.37E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	9.56E-09	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	1.90E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	9.00E-07	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	2.26E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225406731	NA	1.16E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251