\
| Variant ID: vg0225323727 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25323727 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 241. )
TGGGATTAGAGTGCTTGTCAATGGTATTTCATGGATTTTCTCTTTCTTTTTACTAATTTAACTTTCCACCAGACCATCACTCGCTCATTACTGCACATCA[T/C]
CTCGTGTGTGGAGCCCACGTTTGTGTTGGATAAGATTTTCTATGGTTTCTCTAGTCTTGGAGCTTGTGTTTAGTTGGCGATAATTTTATCGTCGGCTTGC
GCAAGCCGACGATAAAATTATCGCCAACTAAACACAAGCTCCAAGACTAGAGAAACCATAGAAAATCTTATCCAACACAAACGTGGGCTCCACACACGAG[A/G]
TGATGTGCAGTAATGAGCGAGTGATGGTCTGGTGGAAAGTTAAATTAGTAAAAAGAAAGAGAAAATCCATGAAATACCATTGACAAGCACTCTAATCCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 11.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 10.50% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 6.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225323727 | T -> C | LOC_Os02g42110.1 | downstream_gene_variant ; 2286.0bp to feature; MODIFIER | silent_mutation | Average:58.779; most accessible tissue: Callus, score: 79.569 | N | N | N | N |
| vg0225323727 | T -> C | LOC_Os02g42120.1 | downstream_gene_variant ; 410.0bp to feature; MODIFIER | silent_mutation | Average:58.779; most accessible tissue: Callus, score: 79.569 | N | N | N | N |
| vg0225323727 | T -> C | LOC_Os02g42120-LOC_Os02g42134 | intergenic_region ; MODIFIER | silent_mutation | Average:58.779; most accessible tissue: Callus, score: 79.569 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225323727 | 1.08E-06 | NA | mr1446_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225323727 | NA | 5.40E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225323727 | NA | 5.87E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |