\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225148969:

Variant ID: vg0225148969 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25148969
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAGACAATAGTGAGCTTGAGGTTCACTGCTTCCTCTTCCTTGGCGAGACATTGGTATCCCTTTCTTCCTCCTCATCCTCAGCCACCAACCCGCGCCTC[A/G]
TCCCCAACGATACGACACAAGGTCATCGTTGTGCACATTTTTCTTCTTCAGATCTAGCCGCAGGTGAGATATATACCCTCTTTCATCGGCTTTTGCAAAT

Reverse complement sequence

ATTTGCAAAAGCCGATGAAAGAGGGTATATATCTCACCTGCGGCTAGATCTGAAGAAGAAAAATGTGCACAACGATGACCTTGTGTCGTATCGTTGGGGA[T/C]
GAGGCGCGGGTTGGTGGCTGAGGATGAGGAGGAAGAAAGGGATACCAATGTCTCGCCAAGGAAGAGGAAGCAGTGAACCTCAAGCTCACTATTGTCTCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 28.40% 0.17% 0.00% NA
All Indica  2759 76.30% 23.60% 0.11% 0.00% NA
All Japonica  1512 70.90% 28.80% 0.26% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 86.10% 13.90% 0.00% 0.00% NA
Indica II  465 72.70% 27.10% 0.22% 0.00% NA
Indica III  913 77.30% 22.70% 0.00% 0.00% NA
Indica Intermediate  786 70.00% 29.80% 0.25% 0.00% NA
Temperate Japonica  767 49.40% 50.10% 0.52% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225148969 A -> G LOC_Os02g41820.1 upstream_gene_variant ; 24.0bp to feature; MODIFIER silent_mutation Average:61.944; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0225148969 A -> G LOC_Os02g41830.1 upstream_gene_variant ; 1482.0bp to feature; MODIFIER silent_mutation Average:61.944; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0225148969 A -> G LOC_Os02g41810.1 downstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:61.944; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0225148969 A -> G LOC_Os02g41840.1 downstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:61.944; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0225148969 A -> G LOC_Os02g41820-LOC_Os02g41830 intergenic_region ; MODIFIER silent_mutation Average:61.944; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225148969 NA 1.41E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225148969 NA 3.35E-08 mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 8.99E-09 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 3.37E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 1.96E-07 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 1.81E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 1.36E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 3.00E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.86E-07 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.85E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 4.31E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 1.60E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.00E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.66E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.11E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 3.23E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.45E-08 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 2.12E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 3.35E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148969 NA 1.63E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251