Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0225142897:

Variant ID: vg0225142897 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25142897
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAGAGCATCCGCAATGATAAATTAATGTGCTCTCTATAAAACATATATATCTCAGCAATAGATTAGATTAATAGTAAACCACCTCAATAGTATGTCTA[C/T]
ATAGGTATCTATAGCTCTCTAATGCACTGCCTCGTTTTTCTCTATAGACTATCTCTATATTAGTAGATAGCTTTGCTCTCTCTCTTTATTTAATCTCTTC

Reverse complement sequence

GAAGAGATTAAATAAAGAGAGAGAGCAAAGCTATCTACTAATATAGAGATAGTCTATAGAGAAAAACGAGGCAGTGCATTAGAGAGCTATAGATACCTAT[G/A]
TAGACATACTATTGAGGTGGTTTACTATTAATCTAATCTATTGCTGAGATATATATGTTTTATAGAGAGCACATTAATTTATCATTGCGGATGCTCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	11.20%	1.50%	0.00%	NA
All Indica	2759	96.60%	3.10%	0.33%	0.00%	NA
All Japonica	1512	69.40%	26.50%	4.03%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	94.60%	4.50%	0.84%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	95.80%	4.10%	0.11%	0.00%	NA
Indica Intermediate	786	96.90%	2.70%	0.38%	0.00%	NA
Temperate Japonica	767	71.40%	21.90%	6.65%	0.00%	NA
Tropical Japonica	504	70.20%	29.40%	0.40%	0.00%	NA
Japonica Intermediate	241	61.40%	35.30%	3.32%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225142897	C -> T	LOC_Os02g41810.1	upstream_gene_variant ; 2565.0bp to feature; MODIFIER	silent_mutation	Average:94.889; most accessible tissue: Minghui63 root, score: 99.08	N	N	N	N
vg0225142897	C -> T	LOC_Os02g41820.1	downstream_gene_variant ; 4048.0bp to feature; MODIFIER	silent_mutation	Average:94.889; most accessible tissue: Minghui63 root, score: 99.08	N	N	N	N
vg0225142897	C -> T	LOC_Os02g41800-LOC_Os02g41810	intergenic_region ; MODIFIER	silent_mutation	Average:94.889; most accessible tissue: Minghui63 root, score: 99.08	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0225142897	C	T	-0.02	-0.02	-0.03	-0.01	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225142897	NA	1.01E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	NA	1.36E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	1.32E-06	NA	mr1252_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	NA	3.85E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	6.41E-06	NA	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	NA	6.86E-06	mr1728_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	4.37E-06	NA	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225142897	NA	2.21E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251