\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224948631:

Variant ID: vg0224948631 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24948631
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGACGAGGCGGCCGGTGAGAGCTCGGCCAGAGGGGCACCAGCGGACGGAGCCCGAGCGTTGGCGGCTGCAGCAGAGGGGAGAGGGAAGGGGATTTGG[G/A]
GAGAAGGGGAGGAAGAAGAAAGTTGTAGAGACTGACATGTGTGCCCTATTGTCATGGACTCATAATAGAGAGGATGAATGGGAAGGCTGTTGGAGTAAAA

Reverse complement sequence

TTTTACTCCAACAGCCTTCCCATTCATCCTCTCTATTATGAGTCCATGACAATAGGGCACACATGTCAGTCTCTACAACTTTCTTCTTCCTCCCCTTCTC[C/T]
CCAAATCCCCTTCCCTCTCCCCTCTGCTGCAGCCGCCAACGCTCGGGCTCCGTCCGCTGGTGCCCCTCTGGCCGAGCTCTCACCGGCCGCCTCGTCTCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.40% 0.02% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 59.90% 40.10% 0.07% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 38.30% 61.50% 0.13% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 53.90% 46.10% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224948631 G -> A LOC_Os02g41590.1 upstream_gene_variant ; 1983.0bp to feature; MODIFIER silent_mutation Average:83.385; most accessible tissue: Minghui63 young leaf, score: 93.121 N N N N
vg0224948631 G -> A LOC_Os02g41610.1 upstream_gene_variant ; 4516.0bp to feature; MODIFIER silent_mutation Average:83.385; most accessible tissue: Minghui63 young leaf, score: 93.121 N N N N
vg0224948631 G -> A LOC_Os02g41590-LOC_Os02g41610 intergenic_region ; MODIFIER silent_mutation Average:83.385; most accessible tissue: Minghui63 young leaf, score: 93.121 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224948631 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224948631 1.99E-08 7.29E-18 Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0224948631 1.69E-06 9.49E-15 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652