\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224802909:

Variant ID: vg0224802909 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24802909
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAGATCAGGGTTACAGCGAGGCCAACCACTGCACCAGGCGGTCGTCCACCAAAGAGACCCGCCTTTGCTCCTTCAGCCCCTCCTGCTCAAGATCGTCA[T/C]
GCACAATCTTACGATGTGTAGTTGCAGTACGACACGGATTTTGGGGAGGACCGAACGGAGGCCGACAGCAAGGCGATTCATGAACCCCCACCGATGAAGA

Reverse complement sequence

TCTTCATCGGTGGGGGTTCATGAATCGCCTTGCTGTCGGCCTCCGTTCGGTCCTCCCCAAAATCCGTGTCGTACTGCAACTACACATCGTAAGATTGTGC[A/G]
TGACGATCTTGAGCAGGAGGGGCTGAAGGAGCAAAGGCGGGTCTCTTTGGTGGACGACCGCCTGGTGCAGTGGTTGGCCTCGCTGTAACCCTGATCTCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 11.90% 0.76% 0.00% NA
All Indica  2759 79.60% 19.10% 1.27% 0.00% NA
All Japonica  1512 97.90% 2.00% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 84.00% 14.30% 1.68% 0.00% NA
Indica II  465 81.30% 18.50% 0.22% 0.00% NA
Indica III  913 79.50% 18.90% 1.53% 0.00% NA
Indica Intermediate  786 75.30% 23.40% 1.27% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224802909 T -> C LOC_Os02g40940.1 upstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:22.94; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0224802909 T -> C LOC_Os02g40920.1 downstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:22.94; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0224802909 T -> C LOC_Os02g40930.1 intron_variant ; MODIFIER silent_mutation Average:22.94; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224802909 NA 3.97E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 3.69E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 6.93E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.11E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 7.33E-06 4.50E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.60E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.51E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 5.13E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 9.65E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.02E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 6.35E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 1.42E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.34E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 4.48E-06 1.18E-07 mr1918_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224802909 NA 7.31E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251