\
| Variant ID: vg0224775330 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24775330 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 112. )
ATATATATATTTTAGTAGTTTAGTTTCACAAAACTACACTGTCGATGTATGGATTCACCTTTTGAGATGACGTGGTCGTTCCATCTAGGATGAGGATGTG[G/A]
CACCCTATTAATTTCGTGCGATGGCTGGTAATAGGATGATATGTCCTCGTCCTAGATGAAACAGTCACATCATCTCACGGGTGAATCCATTCATTGATAG
CTATCAATGAATGGATTCACCCGTGAGATGATGTGACTGTTTCATCTAGGACGAGGACATATCATCCTATTACCAGCCATCGCACGAAATTAATAGGGTG[C/T]
CACATCCTCATCCTAGATGGAACGACCACGTCATCTCAAAAGGTGAATCCATACATCGACAGTGTAGTTTTGTGAAACTAAACTACTAAAATATATATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 44.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 18.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.50% | 22.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.10% | 23.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 57.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224775330 | G -> A | LOC_Os02g40870.1 | upstream_gene_variant ; 290.0bp to feature; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0224775330 | G -> A | LOC_Os02g40870.2 | upstream_gene_variant ; 250.0bp to feature; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0224775330 | G -> A | LOC_Os02g40860.1 | downstream_gene_variant ; 2580.0bp to feature; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0224775330 | G -> A | LOC_Os02g40880.1 | downstream_gene_variant ; 2397.0bp to feature; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0224775330 | G -> A | LOC_Os02g40880.2 | downstream_gene_variant ; 2397.0bp to feature; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0224775330 | G -> A | LOC_Os02g40870-LOC_Os02g40880 | intergenic_region ; MODIFIER | silent_mutation | Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224775330 | 9.00E-06 | NA | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 4.47E-07 | NA | mr1589 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 8.70E-06 | NA | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 1.91E-06 | NA | mr1098_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 9.61E-07 | 9.31E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 3.68E-07 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 9.00E-08 | 2.14E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 3.59E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 1.15E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 3.82E-06 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 2.84E-07 | 4.70E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 6.13E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224775330 | 1.52E-06 | 4.41E-06 | mr1911_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |