Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224775330:

Variant ID: vg0224775330 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24775330
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATATATTTTAGTAGTTTAGTTTCACAAAACTACACTGTCGATGTATGGATTCACCTTTTGAGATGACGTGGTCGTTCCATCTAGGATGAGGATGTG[G/A]
CACCCTATTAATTTCGTGCGATGGCTGGTAATAGGATGATATGTCCTCGTCCTAGATGAAACAGTCACATCATCTCACGGGTGAATCCATTCATTGATAG

Reverse complement sequence

CTATCAATGAATGGATTCACCCGTGAGATGATGTGACTGTTTCATCTAGGACGAGGACATATCATCCTATTACCAGCCATCGCACGAAATTAATAGGGTG[C/T]
CACATCCTCATCCTAGATGGAACGACCACGTCATCTCAAAAGGTGAATCCATACATCGACAGTGTAGTTTTGTGAAACTAAACTACTAAAATATATATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	44.80%	0.06%	0.00%	NA
All Indica	2759	81.80%	18.10%	0.11%	0.00%	NA
All Japonica	1512	5.60%	94.40%	0.00%	0.00%	NA
Aus	269	79.20%	20.80%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	77.50%	22.30%	0.11%	0.00%	NA
Indica Intermediate	786	76.10%	23.70%	0.25%	0.00%	NA
Temperate Japonica	767	5.60%	94.40%	0.00%	0.00%	NA
Tropical Japonica	504	7.50%	92.50%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	42.20%	57.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224775330	G -> A	LOC_Os02g40870.1	upstream_gene_variant ; 290.0bp to feature; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0224775330	G -> A	LOC_Os02g40870.2	upstream_gene_variant ; 250.0bp to feature; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0224775330	G -> A	LOC_Os02g40860.1	downstream_gene_variant ; 2580.0bp to feature; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0224775330	G -> A	LOC_Os02g40880.1	downstream_gene_variant ; 2397.0bp to feature; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0224775330	G -> A	LOC_Os02g40880.2	downstream_gene_variant ; 2397.0bp to feature; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0224775330	G -> A	LOC_Os02g40870-LOC_Os02g40880	intergenic_region ; MODIFIER	silent_mutation	Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224775330	9.00E-06	NA	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	4.47E-07	NA	mr1589	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	8.70E-06	NA	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	1.91E-06	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	9.61E-07	9.31E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	3.68E-07	NA	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	9.00E-08	2.14E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	3.59E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	1.15E-06	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	3.82E-06	NA	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	2.84E-07	4.70E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	6.13E-06	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330	1.52E-06	4.41E-06	mr1911_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251