\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224775330:

Variant ID: vg0224775330 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24775330
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATATATTTTAGTAGTTTAGTTTCACAAAACTACACTGTCGATGTATGGATTCACCTTTTGAGATGACGTGGTCGTTCCATCTAGGATGAGGATGTG[G/A]
CACCCTATTAATTTCGTGCGATGGCTGGTAATAGGATGATATGTCCTCGTCCTAGATGAAACAGTCACATCATCTCACGGGTGAATCCATTCATTGATAG

Reverse complement sequence

CTATCAATGAATGGATTCACCCGTGAGATGATGTGACTGTTTCATCTAGGACGAGGACATATCATCCTATTACCAGCCATCGCACGAAATTAATAGGGTG[C/T]
CACATCCTCATCCTAGATGGAACGACCACGTCATCTCAAAAGGTGAATCCATACATCGACAGTGTAGTTTTGTGAAACTAAACTACTAAAATATATATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 44.80% 0.06% 0.00% NA
All Indica  2759 81.80% 18.10% 0.11% 0.00% NA
All Japonica  1512 5.60% 94.40% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 77.50% 22.30% 0.11% 0.00% NA
Indica Intermediate  786 76.10% 23.70% 0.25% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 7.50% 92.50% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224775330 G -> A LOC_Os02g40870.1 upstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0224775330 G -> A LOC_Os02g40870.2 upstream_gene_variant ; 250.0bp to feature; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0224775330 G -> A LOC_Os02g40860.1 downstream_gene_variant ; 2580.0bp to feature; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0224775330 G -> A LOC_Os02g40880.1 downstream_gene_variant ; 2397.0bp to feature; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0224775330 G -> A LOC_Os02g40880.2 downstream_gene_variant ; 2397.0bp to feature; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0224775330 G -> A LOC_Os02g40870-LOC_Os02g40880 intergenic_region ; MODIFIER silent_mutation Average:63.427; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224775330 9.00E-06 NA mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 4.47E-07 NA mr1589 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 8.70E-06 NA mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 1.91E-06 NA mr1098_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 9.61E-07 9.31E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 3.68E-07 NA mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 9.00E-08 2.14E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 3.59E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 1.15E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 3.82E-06 NA mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 2.84E-07 4.70E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 6.13E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224775330 1.52E-06 4.41E-06 mr1911_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251