Variant ID: vg0224702963 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 24702963 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
AAAGACCAAACATCAAACAAACAAAAATATCGAAACATTCTTTATAAAACGAGAAACAAATAAAGTATAAAAACTGCAGTATCATCACTGGTGGAGGAAC[C/T]
ATCTTTGGTCGGTCCACCAGATTTCACAATAGTCCCGGTTATATTAAAAACCGGGAATAAAAACATCTTTAGTCCCAGTTTGAAAGCTCTGATGAATTTT
AAAATTCATCAGAGCTTTCAAACTGGGACTAAAGATGTTTTTATTCCCGGTTTTTAATATAACCGGGACTATTGTGAAATCTGGTGGACCGACCAAAGAT[G/A]
GTTCCTCCACCAGTGATGATACTGCAGTTTTTATACTTTATTTGTTTCTCGTTTTATAAAGAATGTTTCGATATTTTTGTTTGTTTGATGTTTGGTCTTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.20% | 12.80% | 0.04% | 0.00% | NA |
All Indica | 2759 | 81.60% | 18.30% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 77.50% | 22.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 79.00% | 20.70% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0224702963 | C -> T | LOC_Os02g40750.1 | upstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:25.573; most accessible tissue: Callus, score: 54.365 | N | N | N | N |
vg0224702963 | C -> T | LOC_Os02g40760.1 | upstream_gene_variant ; 1285.0bp to feature; MODIFIER | silent_mutation | Average:25.573; most accessible tissue: Callus, score: 54.365 | N | N | N | N |
vg0224702963 | C -> T | LOC_Os02g40760-LOC_Os02g40770 | intergenic_region ; MODIFIER | silent_mutation | Average:25.573; most accessible tissue: Callus, score: 54.365 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0224702963 | NA | 5.82E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | NA | 9.14E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | NA | 5.26E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | 5.86E-06 | 1.59E-10 | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | NA | 4.19E-08 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | 4.40E-06 | NA | mr1795_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | 1.45E-06 | 5.50E-10 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0224702963 | NA | 9.18E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |