Variant ID: vg0224663540 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 24663540 |
Reference Allele: G | Alternative Allele: A,T |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.08, T: 0.02, others allele: 0.00, population size: 103. )
AAGAAAATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAAGTCAAACGTTTATCAAAAAGTCAACG[G/A,T]
CGTCATACATTAAAATACGGAGGGAGTATATTAGTTACTCCCTCGGTCCCATAATATAGTAACCTAGTATAGGATGTGACACTTCATACTTCATAGTACA
TGTACTATGAAGTATGAAGTGTCACATCCTATACTAGGTTACTATATTATGGGACCGAGGGAGTAACTAATATACTCCCTCCGTATTTTAATGTATGACG[C/T,A]
CGTTGACTTTTTGATAAACGTTTGACTTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATTTTCTT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.40% | 5.50% | 0.32% | 0.15% | T: 0.63% |
All Indica | 2759 | 90.10% | 8.90% | 0.43% | 0.25% | T: 0.33% |
All Japonica | 1512 | 98.90% | 0.10% | 0.00% | 0.00% | T: 0.99% |
Aus | 269 | 95.50% | 2.60% | 0.37% | 0.00% | T: 1.49% |
Indica I | 595 | 98.20% | 0.30% | 0.84% | 0.67% | NA |
Indica II | 465 | 86.70% | 12.00% | 1.08% | 0.22% | NA |
Indica III | 913 | 86.20% | 12.70% | 0.00% | 0.11% | T: 0.99% |
Indica Intermediate | 786 | 90.50% | 9.20% | 0.25% | 0.13% | NA |
Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.00% | T: 0.13% |
Tropical Japonica | 504 | 98.60% | 0.20% | 0.00% | 0.00% | T: 1.19% |
Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 0.00% | T: 3.32% |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 88.90% | 6.70% | 2.22% | 0.00% | T: 2.22% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0224663540 | G -> A | LOC_Os02g40680.1 | upstream_gene_variant ; 3711.0bp to feature; MODIFIER | silent_mutation | Average:53.637; most accessible tissue: Callus, score: 72.788 | N | N | N | N |
vg0224663540 | G -> A | LOC_Os02g40664-LOC_Os02g40680 | intergenic_region ; MODIFIER | silent_mutation | Average:53.637; most accessible tissue: Callus, score: 72.788 | N | N | N | N |
vg0224663540 | G -> T | LOC_Os02g40680.1 | upstream_gene_variant ; 3711.0bp to feature; MODIFIER | silent_mutation | Average:53.637; most accessible tissue: Callus, score: 72.788 | N | N | N | N |
vg0224663540 | G -> T | LOC_Os02g40664-LOC_Os02g40680 | intergenic_region ; MODIFIER | silent_mutation | Average:53.637; most accessible tissue: Callus, score: 72.788 | N | N | N | N |
vg0224663540 | G -> DEL | N | N | silent_mutation | Average:53.637; most accessible tissue: Callus, score: 72.788 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0224663540 | 3.40E-06 | 3.40E-06 | mr1673 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |