\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224640322:

Variant ID: vg0224640322 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24640322
Reference Allele: CAlternative Allele: A,T,CT,CTT,CTTTT
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAAAGAAAGAAGTGCGACCATTAATTTTGACAATGTGAACCTTTGCAAAAACTAATTTTACAAATGAACCGTCCGCCAAAACTTATTTCAAAAGTGAC[C/A,T,CT,CTT,CTTTT]
CTTTTTTCAGCGCCAAATCGTGTGGCGCTGAACTTAGACACCTCAGCGCCACATCACCTGGCGCTGAATGCCGTGCCACCGTAGATGGAAGGCTGAGTCA

Reverse complement sequence

TGACTCAGCCTTCCATCTACGGTGGCACGGCATTCAGCGCCAGGTGATGTGGCGCTGAGGTGTCTAAGTTCAGCGCCACACGATTTGGCGCTGAAAAAAG[G/T,A,AG,AAG,AAAAG]
GTCACTTTTGAAATAAGTTTTGGCGGACGGTTCATTTGTAAAATTAGTTTTTGCAAAGGTTCACATTGTCAAAATTAATGGTCGCACTTCTTTCTTTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 9.30% 0.68% 1.54% CT: 6.88%; CTT: 0.47%; T: 0.08%; CTTTT: 0.02%
All Indica  2759 84.20% 11.60% 0.51% 1.96% CT: 1.45%; CTT: 0.14%; T: 0.11%
All Japonica  1512 79.20% 0.10% 0.66% 0.99% CT: 17.92%; CTT: 0.99%; CTTTT: 0.07%; T: 0.07%
Aus  269 53.50% 41.30% 1.49% 1.12% CT: 2.23%; CTT: 0.37%
Indica I  595 98.30% 0.20% 0.34% 0.34% CT: 0.50%; T: 0.17%; CTT: 0.17%
Indica II  465 61.10% 30.50% 1.29% 6.45% T: 0.43%; CT: 0.22%
Indica III  913 93.20% 5.30% 0.11% 0.55% CT: 0.88%
Indica Intermediate  786 76.70% 16.50% 0.64% 2.16% CT: 3.56%; CTT: 0.38%
Temperate Japonica  767 80.20% 0.10% 0.39% 0.26% CT: 17.60%; CTT: 1.43%
Tropical Japonica  504 81.30% 0.20% 0.99% 1.19% CT: 15.08%; CTT: 0.79%; T: 0.20%; CTTTT: 0.20%
Japonica Intermediate  241 71.40% 0.00% 0.83% 2.90% CT: 24.90%
VI/Aromatic  96 94.80% 1.00% 3.12% 0.00% CTT: 1.04%
Intermediate  90 83.30% 4.40% 1.11% 1.11% CT: 8.89%; CTT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224640322 C -> A LOC_Os02g40630.1 upstream_gene_variant ; 4323.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> A LOC_Os02g40650.1 upstream_gene_variant ; 3071.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> A LOC_Os02g40640.1 downstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> A LOC_Os02g40630-LOC_Os02g40640 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> DEL N N silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTT LOC_Os02g40630.1 upstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTT LOC_Os02g40650.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTT LOC_Os02g40640.1 downstream_gene_variant ; 960.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTT LOC_Os02g40630-LOC_Os02g40640 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTTTT LOC_Os02g40630.1 upstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTTTT LOC_Os02g40650.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTTTT LOC_Os02g40640.1 downstream_gene_variant ; 960.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CTTTT LOC_Os02g40630-LOC_Os02g40640 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CT LOC_Os02g40630.1 upstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CT LOC_Os02g40650.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CT LOC_Os02g40640.1 downstream_gene_variant ; 960.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> CT LOC_Os02g40630-LOC_Os02g40640 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> T LOC_Os02g40630.1 upstream_gene_variant ; 4323.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> T LOC_Os02g40650.1 upstream_gene_variant ; 3071.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> T LOC_Os02g40640.1 downstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0224640322 C -> T LOC_Os02g40630-LOC_Os02g40640 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224640322 NA 8.15E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 4.46E-06 NA mr1589 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 7.61E-06 6.21E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 NA 1.41E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 5.85E-06 NA mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 9.26E-06 3.28E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 4.39E-07 2.83E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 9.61E-06 3.07E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 NA 6.85E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322 3.04E-06 4.15E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251