\
| Variant ID: vg0224640322 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 24640322 |
| Reference Allele: C | Alternative Allele: A,T,CT,CTT,CTTTT |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGAAAGAAAGAAGTGCGACCATTAATTTTGACAATGTGAACCTTTGCAAAAACTAATTTTACAAATGAACCGTCCGCCAAAACTTATTTCAAAAGTGAC[C/A,T,CT,CTT,CTTTT]
CTTTTTTCAGCGCCAAATCGTGTGGCGCTGAACTTAGACACCTCAGCGCCACATCACCTGGCGCTGAATGCCGTGCCACCGTAGATGGAAGGCTGAGTCA
TGACTCAGCCTTCCATCTACGGTGGCACGGCATTCAGCGCCAGGTGATGTGGCGCTGAGGTGTCTAAGTTCAGCGCCACACGATTTGGCGCTGAAAAAAG[G/T,A,AG,AAG,AAAAG]
GTCACTTTTGAAATAAGTTTTGGCGGACGGTTCATTTGTAAAATTAGTTTTTGCAAAGGTTCACATTGTCAAAATTAATGGTCGCACTTCTTTCTTTCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 9.30% | 0.68% | 1.54% | CT: 6.88%; CTT: 0.47%; T: 0.08%; CTTTT: 0.02% |
| All Indica | 2759 | 84.20% | 11.60% | 0.51% | 1.96% | CT: 1.45%; CTT: 0.14%; T: 0.11% |
| All Japonica | 1512 | 79.20% | 0.10% | 0.66% | 0.99% | CT: 17.92%; CTT: 0.99%; CTTTT: 0.07%; T: 0.07% |
| Aus | 269 | 53.50% | 41.30% | 1.49% | 1.12% | CT: 2.23%; CTT: 0.37% |
| Indica I | 595 | 98.30% | 0.20% | 0.34% | 0.34% | CT: 0.50%; T: 0.17%; CTT: 0.17% |
| Indica II | 465 | 61.10% | 30.50% | 1.29% | 6.45% | T: 0.43%; CT: 0.22% |
| Indica III | 913 | 93.20% | 5.30% | 0.11% | 0.55% | CT: 0.88% |
| Indica Intermediate | 786 | 76.70% | 16.50% | 0.64% | 2.16% | CT: 3.56%; CTT: 0.38% |
| Temperate Japonica | 767 | 80.20% | 0.10% | 0.39% | 0.26% | CT: 17.60%; CTT: 1.43% |
| Tropical Japonica | 504 | 81.30% | 0.20% | 0.99% | 1.19% | CT: 15.08%; CTT: 0.79%; T: 0.20%; CTTTT: 0.20% |
| Japonica Intermediate | 241 | 71.40% | 0.00% | 0.83% | 2.90% | CT: 24.90% |
| VI/Aromatic | 96 | 94.80% | 1.00% | 3.12% | 0.00% | CTT: 1.04% |
| Intermediate | 90 | 83.30% | 4.40% | 1.11% | 1.11% | CT: 8.89%; CTT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224640322 | C -> A | LOC_Os02g40630.1 | upstream_gene_variant ; 4323.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> A | LOC_Os02g40650.1 | upstream_gene_variant ; 3071.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> A | LOC_Os02g40640.1 | downstream_gene_variant ; 961.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> A | LOC_Os02g40630-LOC_Os02g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> DEL | N | N | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTT | LOC_Os02g40630.1 | upstream_gene_variant ; 4324.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTT | LOC_Os02g40650.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTT | LOC_Os02g40640.1 | downstream_gene_variant ; 960.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTT | LOC_Os02g40630-LOC_Os02g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTTTT | LOC_Os02g40630.1 | upstream_gene_variant ; 4324.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTTTT | LOC_Os02g40650.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTTTT | LOC_Os02g40640.1 | downstream_gene_variant ; 960.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CTTTT | LOC_Os02g40630-LOC_Os02g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CT | LOC_Os02g40630.1 | upstream_gene_variant ; 4324.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CT | LOC_Os02g40650.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CT | LOC_Os02g40640.1 | downstream_gene_variant ; 960.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> CT | LOC_Os02g40630-LOC_Os02g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> T | LOC_Os02g40630.1 | upstream_gene_variant ; 4323.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> T | LOC_Os02g40650.1 | upstream_gene_variant ; 3071.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> T | LOC_Os02g40640.1 | downstream_gene_variant ; 961.0bp to feature; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0224640322 | C -> T | LOC_Os02g40630-LOC_Os02g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:50.038; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224640322 | NA | 8.15E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 4.46E-06 | NA | mr1589 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 7.61E-06 | 6.21E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | NA | 1.41E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 5.85E-06 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 9.26E-06 | 3.28E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 4.39E-07 | 2.83E-08 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 9.61E-06 | 3.07E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | NA | 6.85E-06 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224640322 | 3.04E-06 | 4.15E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |