\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224508452:

Variant ID: vg0224508452 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24508452
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATGTTTCACCTAGTGTATTTATAATGGTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAACGCACATATTTT[G/A]
GAAACTCTCTATTAAGGAAATTTGGTTTATTTTTTTCCATAAAAAATATTTTACCTAGTGTACTCACAATGTTTTACTATGTATAGATCTAATGTTGCAG

Reverse complement sequence

CTGCAACATTAGATCTATACATAGTAAAACATTGTGAGTACACTAGGTAAAATATTTTTTATGGAAAAAAATAAACCAAATTTCCTTAATAGAGAGTTTC[C/T]
AAAATATGTGCGTTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAACCATTATAAATACACTAGGTGAAACATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 8.60% 0.21% 1.65% NA
All Indica  2759 89.50% 9.70% 0.11% 0.69% NA
All Japonica  1512 92.30% 4.00% 0.07% 3.70% NA
Aus  269 70.60% 27.10% 1.86% 0.37% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 83.20% 16.10% 0.00% 0.65% NA
Indica III  913 91.70% 7.80% 0.00% 0.55% NA
Indica Intermediate  786 85.10% 13.10% 0.38% 1.40% NA
Temperate Japonica  767 95.80% 2.20% 0.00% 1.96% NA
Tropical Japonica  504 88.90% 5.60% 0.00% 5.56% NA
Japonica Intermediate  241 88.00% 6.20% 0.41% 5.39% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 3.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224508452 G -> A LOC_Os02g40430-LOC_Os02g40440 intergenic_region ; MODIFIER silent_mutation Average:79.09; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg0224508452 G -> DEL N N silent_mutation Average:79.09; most accessible tissue: Minghui63 root, score: 89.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224508452 NA 5.64E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508452 NA 7.75E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508452 2.53E-06 NA mr1589 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251