\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224508339:

Variant ID: vg0224508339 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24508339
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTCGCCGGGCGACCGGCGCGGGGGGAGCCGGATCAAGCACTCCCCCCACGCGCGCCTCTCCCCCACGTGCTACCTGTTGTCCCACACACTTCTTCCTT[C/T]
CTTTTTCCACAATAGATGTTTCACCTAGTGTATTTATAATGGTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAA

Reverse complement sequence

TTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAACCATTATAAATACACTAGGTGAAACATCTATTGTGGAAAAAG[G/A]
AAGGAAGAAGTGTGTGGGACAACAGGTAGCACGTGGGGGAGAGGCGCGCGTGGGGGGAGTGCTTGATCCGGCTCCCCCCGCGCCGGTCGCCCGGCGACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 25.10% 0.23% 1.35% NA
All Indica  2759 79.80% 19.80% 0.14% 0.25% NA
All Japonica  1512 61.20% 34.70% 0.46% 3.64% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 80.60% 19.40% 0.00% 0.00% NA
Indica III  913 68.50% 31.10% 0.22% 0.22% NA
Indica Intermediate  786 78.60% 20.50% 0.25% 0.64% NA
Temperate Japonica  767 66.60% 30.50% 0.91% 1.96% NA
Tropical Japonica  504 54.40% 40.30% 0.00% 5.36% NA
Japonica Intermediate  241 58.10% 36.50% 0.00% 5.39% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224508339 C -> T LOC_Os02g40430-LOC_Os02g40440 intergenic_region ; MODIFIER silent_mutation Average:89.27; most accessible tissue: Zhenshan97 panicle, score: 95.264 N N N N
vg0224508339 C -> DEL N N silent_mutation Average:89.27; most accessible tissue: Zhenshan97 panicle, score: 95.264 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224508339 C T 0.04 0.03 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224508339 NA 4.20E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 4.61E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 5.21E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.73E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 6.20E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 4.77E-08 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 1.03E-06 NA mr1202 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 4.20E-06 1.91E-10 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.22E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.28E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 2.03E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 2.80E-11 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.58E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.31E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 1.96E-06 8.36E-12 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 2.91E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 5.48E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 5.90E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508339 NA 1.38E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251