\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224508221:

Variant ID: vg0224508221 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24508221
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAAAAGAAAAGAGGACGGGCCGAATGATTTTAATTCTCAGCCAACTTGGGCCTGTAACGATCTAGCCCATCACGACCCATTCGGTTAAAACACCT[G/A]
GGTAATAACGATAATGCTTGTCGCCGGGCGACCGGCGCGGGGGGAGCCGGATCAAGCACTCCCCCCACGCGCGCCTCTCCCCCACGTGCTACCTGTTGTC

Reverse complement sequence

GACAACAGGTAGCACGTGGGGGAGAGGCGCGCGTGGGGGGAGTGCTTGATCCGGCTCCCCCCGCGCCGGTCGCCCGGCGACAAGCATTATCGTTATTACC[C/T]
AGGTGTTTTAACCGAATGGGTCGTGATGGGCTAGATCGTTACAGGCCCAAGTTGGCTGAGAATTAAAATCATTCGGCCCGTCCTCTTTTCTTTTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 5.30% 1.31% 0.00% NA
All Indica  2759 92.00% 7.80% 0.29% 0.00% NA
All Japonica  1512 95.80% 0.70% 3.44% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 83.40% 16.60% 0.00% 0.00% NA
Indica III  913 93.00% 6.70% 0.33% 0.00% NA
Indica Intermediate  786 89.80% 9.50% 0.64% 0.00% NA
Temperate Japonica  767 97.90% 0.10% 1.96% 0.00% NA
Tropical Japonica  504 93.70% 1.60% 4.76% 0.00% NA
Japonica Intermediate  241 93.80% 0.80% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224508221 G -> A LOC_Os02g40430-LOC_Os02g40440 intergenic_region ; MODIFIER silent_mutation Average:92.255; most accessible tissue: Callus, score: 98.591 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224508221 G A -0.16 -0.16 -0.14 -0.12 -0.1 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224508221 NA 2.05E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 4.90E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 3.31E-06 2.11E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 6.89E-06 1.18E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 NA 4.27E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 9.02E-06 1.48E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 NA 1.38E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 NA 8.14E-08 mr1406_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 NA 6.65E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508221 NA 3.79E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251