\
| Variant ID: vg0224478551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24478551 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )
ACATATGCTTATATATACATGCGCACTCCCTTCTATAAATATTAGTATCTACTCGTATATTATATCGCTTATAAATTTTTTGAAAATGTACCAGTATTTT[C/A]
TAAAATTTATGAAGTTATCACATACAACTCACTATTGACAATTATGTTATCTATCACAAACAAAAGAGATAATCATAAATATAAATATAAGGACCATATC
GATATGGTCCTTATATTTATATTTATGATTATCTCTTTTGTTTGTGATAGATAACATAATTGTCAATAGTGAGTTGTATGTGATAACTTCATAAATTTTA[G/T]
AAAATACTGGTACATTTTCAAAAAATTTATAAGCGATATAATATACGAGTAGATACTAATATTTATAGAAGGGAGTGCGCATGTATATATAAGCATATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224478551 | C -> A | LOC_Os02g40410.1 | upstream_gene_variant ; 1228.0bp to feature; MODIFIER | silent_mutation | Average:43.924; most accessible tissue: Callus, score: 89.373 | N | N | N | N |
| vg0224478551 | C -> A | LOC_Os02g40410.2 | upstream_gene_variant ; 2898.0bp to feature; MODIFIER | silent_mutation | Average:43.924; most accessible tissue: Callus, score: 89.373 | N | N | N | N |
| vg0224478551 | C -> A | LOC_Os02g40420.1 | downstream_gene_variant ; 4439.0bp to feature; MODIFIER | silent_mutation | Average:43.924; most accessible tissue: Callus, score: 89.373 | N | N | N | N |
| vg0224478551 | C -> A | LOC_Os02g40410-LOC_Os02g40420 | intergenic_region ; MODIFIER | silent_mutation | Average:43.924; most accessible tissue: Callus, score: 89.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224478551 | NA | 1.55E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | 9.55E-06 | NA | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | NA | 6.81E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | NA | 5.88E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | 4.42E-06 | 2.79E-07 | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | 8.45E-07 | 2.28E-07 | mr1328 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | 1.18E-06 | 1.23E-08 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224478551 | 1.11E-07 | 1.05E-08 | mr1446 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |