\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224478551:

Variant ID: vg0224478551 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24478551
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACATATGCTTATATATACATGCGCACTCCCTTCTATAAATATTAGTATCTACTCGTATATTATATCGCTTATAAATTTTTTGAAAATGTACCAGTATTTT[C/A]
TAAAATTTATGAAGTTATCACATACAACTCACTATTGACAATTATGTTATCTATCACAAACAAAAGAGATAATCATAAATATAAATATAAGGACCATATC

Reverse complement sequence

GATATGGTCCTTATATTTATATTTATGATTATCTCTTTTGTTTGTGATAGATAACATAATTGTCAATAGTGAGTTGTATGTGATAACTTCATAAATTTTA[G/T]
AAAATACTGGTACATTTTCAAAAAATTTATAAGCGATATAATATACGAGTAGATACTAATATTTATAGAAGGGAGTGCGCATGTATATATAAGCATATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.20% 0.02% 0.00% NA
All Indica  2759 92.80% 7.20% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 93.00% 7.00% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224478551 C -> A LOC_Os02g40410.1 upstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:43.924; most accessible tissue: Callus, score: 89.373 N N N N
vg0224478551 C -> A LOC_Os02g40410.2 upstream_gene_variant ; 2898.0bp to feature; MODIFIER silent_mutation Average:43.924; most accessible tissue: Callus, score: 89.373 N N N N
vg0224478551 C -> A LOC_Os02g40420.1 downstream_gene_variant ; 4439.0bp to feature; MODIFIER silent_mutation Average:43.924; most accessible tissue: Callus, score: 89.373 N N N N
vg0224478551 C -> A LOC_Os02g40410-LOC_Os02g40420 intergenic_region ; MODIFIER silent_mutation Average:43.924; most accessible tissue: Callus, score: 89.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224478551 NA 1.55E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 9.55E-06 NA mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 NA 6.81E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 NA 5.88E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 4.42E-06 2.79E-07 mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 8.45E-07 2.28E-07 mr1328 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 1.18E-06 1.23E-08 mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551 1.11E-07 1.05E-08 mr1446 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251