Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224478551:

Variant ID: vg0224478551 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24478551
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACATATGCTTATATATACATGCGCACTCCCTTCTATAAATATTAGTATCTACTCGTATATTATATCGCTTATAAATTTTTTGAAAATGTACCAGTATTTT[C/A]
TAAAATTTATGAAGTTATCACATACAACTCACTATTGACAATTATGTTATCTATCACAAACAAAAGAGATAATCATAAATATAAATATAAGGACCATATC

Reverse complement sequence

GATATGGTCCTTATATTTATATTTATGATTATCTCTTTTGTTTGTGATAGATAACATAATTGTCAATAGTGAGTTGTATGTGATAACTTCATAAATTTTA[G/T]
AAAATACTGGTACATTTTCAAAAAATTTATAAGCGATATAATATACGAGTAGATACTAATATTTATAGAAGGGAGTGCGCATGTATATATAAGCATATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	5.20%	0.02%	0.00%	NA
All Indica	2759	92.80%	7.20%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	85.90%	14.10%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	83.20%	16.80%	0.00%	0.00%	NA
Indica III	913	93.00%	7.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	7.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224478551	C -> A	LOC_Os02g40410.1	upstream_gene_variant ; 1228.0bp to feature; MODIFIER	silent_mutation	Average:43.924; most accessible tissue: Callus, score: 89.373	N	N	N	N
vg0224478551	C -> A	LOC_Os02g40410.2	upstream_gene_variant ; 2898.0bp to feature; MODIFIER	silent_mutation	Average:43.924; most accessible tissue: Callus, score: 89.373	N	N	N	N
vg0224478551	C -> A	LOC_Os02g40420.1	downstream_gene_variant ; 4439.0bp to feature; MODIFIER	silent_mutation	Average:43.924; most accessible tissue: Callus, score: 89.373	N	N	N	N
vg0224478551	C -> A	LOC_Os02g40410-LOC_Os02g40420	intergenic_region ; MODIFIER	silent_mutation	Average:43.924; most accessible tissue: Callus, score: 89.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224478551	NA	1.55E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	9.55E-06	NA	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	NA	6.81E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	NA	5.88E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	4.42E-06	2.79E-07	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	8.45E-07	2.28E-07	mr1328	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	1.18E-06	1.23E-08	mr1446	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224478551	1.11E-07	1.05E-08	mr1446	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251