Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224382766:

Variant ID: vg0224382766 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24382766
Reference Allele: A	Alternative Allele: AC,G,C
Primary Allele: A	Secondary Allele: AC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTCCATAGAACAACCTCACAGAGTATTGAGCCTCCGTTGACGACGTGGATGGACTTGAGATGAAATTCCGATCAACTGAATCCATGCCACTAACGCGA[A/AC,G,C]
CCCTCGTTCTATATTCATGTTCTGCGTGTGTATACGAGATCCAATGGGTATTCCGTATCCGATATCACCAACCTACAGACGTGTAGGATGCTGTTTTATT

Reverse complement sequence

AATAAAACAGCATCCTACACGTCTGTAGGTTGGTGATATCGGATACGGAATACCCATTGGATCTCGTATACACACGCAGAACATGAATATAGAACGAGGG[T/GT,C,G]
TCGCGTTAGTGGCATGGATTCAGTTGATCGGAATTTCATCTCAAGTCCATCCACGTCGTCAACGGAGGCTCAATACTCTGTGAGGTTGTTCTATGGAGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of AC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	19.10%	1.12%	0.99%	G: 4.13%; C: 0.04%
All Indica	2759	81.30%	16.20%	0.43%	0.36%	G: 1.67%
All Japonica	1512	59.90%	27.20%	2.38%	1.32%	G: 9.13%; C: 0.13%
Aus	269	88.10%	8.60%	0.37%	2.97%	NA
Indica I	595	61.70%	37.80%	0.50%	0.00%	NA
Indica II	465	96.10%	3.70%	0.00%	0.00%	G: 0.22%
Indica III	913	80.80%	14.70%	0.33%	0.88%	G: 3.29%
Indica Intermediate	786	88.00%	9.00%	0.76%	0.25%	G: 1.91%
Temperate Japonica	767	48.80%	34.40%	3.39%	1.69%	G: 11.73%
Tropical Japonica	504	81.30%	10.70%	1.59%	0.99%	G: 4.96%; C: 0.40%
Japonica Intermediate	241	50.20%	38.60%	0.83%	0.83%	G: 9.54%
VI/Aromatic	96	79.20%	5.20%	1.04%	8.33%	G: 6.25%
Intermediate	90	72.20%	17.80%	3.33%	1.11%	G: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224382766	A -> AC	LOC_Os02g40270.1	upstream_gene_variant ; 94.0bp to feature; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> AC	LOC_Os02g40270-LOC_Os02g40280	intergenic_region ; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> G	LOC_Os02g40270.1	upstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> G	LOC_Os02g40270-LOC_Os02g40280	intergenic_region ; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> DEL	N	N	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> C	LOC_Os02g40270.1	upstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N
vg0224382766	A -> C	LOC_Os02g40270-LOC_Os02g40280	intergenic_region ; MODIFIER	silent_mutation	Average:72.737; most accessible tissue: Callus, score: 84.604	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224382766	3.53E-06	4.12E-06	mr1621	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766	2.30E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766	5.08E-06	NA	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766	8.78E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251