\
| Variant ID: vg0224382766 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 24382766 |
| Reference Allele: A | Alternative Allele: AC,G,C |
| Primary Allele: A | Secondary Allele: AC |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )
TCCTCCATAGAACAACCTCACAGAGTATTGAGCCTCCGTTGACGACGTGGATGGACTTGAGATGAAATTCCGATCAACTGAATCCATGCCACTAACGCGA[A/AC,G,C]
CCCTCGTTCTATATTCATGTTCTGCGTGTGTATACGAGATCCAATGGGTATTCCGTATCCGATATCACCAACCTACAGACGTGTAGGATGCTGTTTTATT
AATAAAACAGCATCCTACACGTCTGTAGGTTGGTGATATCGGATACGGAATACCCATTGGATCTCGTATACACACGCAGAACATGAATATAGAACGAGGG[T/GT,C,G]
TCGCGTTAGTGGCATGGATTCAGTTGATCGGAATTTCATCTCAAGTCCATCCACGTCGTCAACGGAGGCTCAATACTCTGTGAGGTTGTTCTATGGAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 19.10% | 1.12% | 0.99% | G: 4.13%; C: 0.04% |
| All Indica | 2759 | 81.30% | 16.20% | 0.43% | 0.36% | G: 1.67% |
| All Japonica | 1512 | 59.90% | 27.20% | 2.38% | 1.32% | G: 9.13%; C: 0.13% |
| Aus | 269 | 88.10% | 8.60% | 0.37% | 2.97% | NA |
| Indica I | 595 | 61.70% | 37.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.00% | 0.00% | G: 0.22% |
| Indica III | 913 | 80.80% | 14.70% | 0.33% | 0.88% | G: 3.29% |
| Indica Intermediate | 786 | 88.00% | 9.00% | 0.76% | 0.25% | G: 1.91% |
| Temperate Japonica | 767 | 48.80% | 34.40% | 3.39% | 1.69% | G: 11.73% |
| Tropical Japonica | 504 | 81.30% | 10.70% | 1.59% | 0.99% | G: 4.96%; C: 0.40% |
| Japonica Intermediate | 241 | 50.20% | 38.60% | 0.83% | 0.83% | G: 9.54% |
| VI/Aromatic | 96 | 79.20% | 5.20% | 1.04% | 8.33% | G: 6.25% |
| Intermediate | 90 | 72.20% | 17.80% | 3.33% | 1.11% | G: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224382766 | A -> AC | LOC_Os02g40270.1 | upstream_gene_variant ; 94.0bp to feature; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> AC | LOC_Os02g40270-LOC_Os02g40280 | intergenic_region ; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> G | LOC_Os02g40270.1 | upstream_gene_variant ; 93.0bp to feature; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> G | LOC_Os02g40270-LOC_Os02g40280 | intergenic_region ; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> DEL | N | N | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> C | LOC_Os02g40270.1 | upstream_gene_variant ; 93.0bp to feature; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg0224382766 | A -> C | LOC_Os02g40270-LOC_Os02g40280 | intergenic_region ; MODIFIER | silent_mutation | Average:72.737; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224382766 | 3.53E-06 | 4.12E-06 | mr1621 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224382766 | 2.30E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224382766 | 5.08E-06 | NA | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224382766 | 8.78E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |