\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224382766:

Variant ID: vg0224382766 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24382766
Reference Allele: AAlternative Allele: AC,G,C
Primary Allele: ASecondary Allele: AC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCCATAGAACAACCTCACAGAGTATTGAGCCTCCGTTGACGACGTGGATGGACTTGAGATGAAATTCCGATCAACTGAATCCATGCCACTAACGCGA[A/AC,G,C]
CCCTCGTTCTATATTCATGTTCTGCGTGTGTATACGAGATCCAATGGGTATTCCGTATCCGATATCACCAACCTACAGACGTGTAGGATGCTGTTTTATT

Reverse complement sequence

AATAAAACAGCATCCTACACGTCTGTAGGTTGGTGATATCGGATACGGAATACCCATTGGATCTCGTATACACACGCAGAACATGAATATAGAACGAGGG[T/GT,C,G]
TCGCGTTAGTGGCATGGATTCAGTTGATCGGAATTTCATCTCAAGTCCATCCACGTCGTCAACGGAGGCTCAATACTCTGTGAGGTTGTTCTATGGAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 19.10% 1.12% 0.99% G: 4.13%; C: 0.04%
All Indica  2759 81.30% 16.20% 0.43% 0.36% G: 1.67%
All Japonica  1512 59.90% 27.20% 2.38% 1.32% G: 9.13%; C: 0.13%
Aus  269 88.10% 8.60% 0.37% 2.97% NA
Indica I  595 61.70% 37.80% 0.50% 0.00% NA
Indica II  465 96.10% 3.70% 0.00% 0.00% G: 0.22%
Indica III  913 80.80% 14.70% 0.33% 0.88% G: 3.29%
Indica Intermediate  786 88.00% 9.00% 0.76% 0.25% G: 1.91%
Temperate Japonica  767 48.80% 34.40% 3.39% 1.69% G: 11.73%
Tropical Japonica  504 81.30% 10.70% 1.59% 0.99% G: 4.96%; C: 0.40%
Japonica Intermediate  241 50.20% 38.60% 0.83% 0.83% G: 9.54%
VI/Aromatic  96 79.20% 5.20% 1.04% 8.33% G: 6.25%
Intermediate  90 72.20% 17.80% 3.33% 1.11% G: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224382766 A -> AC LOC_Os02g40270.1 upstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> AC LOC_Os02g40270-LOC_Os02g40280 intergenic_region ; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> G LOC_Os02g40270.1 upstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> G LOC_Os02g40270-LOC_Os02g40280 intergenic_region ; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> DEL N N silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> C LOC_Os02g40270.1 upstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N
vg0224382766 A -> C LOC_Os02g40270-LOC_Os02g40280 intergenic_region ; MODIFIER silent_mutation Average:72.737; most accessible tissue: Callus, score: 84.604 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224382766 3.53E-06 4.12E-06 mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766 2.30E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766 5.08E-06 NA mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224382766 8.78E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251