\
| Variant ID: vg0224323955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24323955 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCCAAGCGGAGCCTTAAGTTCTTGGAACACTAGCACTCACTTCTGTTGGTGGAAAGGTGTCATGTGCACCACTGCACGGCCGTTTCGCGTCTCAACGC[T/A]
GAATCTCTCCGCCCAAAGCTTGGCAGGGGAAATCACCTCCTCCCTTGCAAACCTCACGTTTCTTCGTGCACTTGACTTGTCCTCAAATCGCTTCTTTGGT
ACCAAAGAAGCGATTTGAGGACAAGTCAAGTGCACGAAGAAACGTGAGGTTTGCAAGGGAGGAGGTGATTTCCCCTGCCAAGCTTTGGGCGGAGAGATTC[A/T]
GCGTTGAGACGCGAAACGGCCGTGCAGTGGTGCACATGACACCTTTCCACCAACAGAAGTGAGTGCTAGTGTTCCAAGAACTTAAGGCTCCGCTTGGATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 6.10% | 1.65% | 30.81% | NA |
| All Indica | 2759 | 62.80% | 4.00% | 1.99% | 31.28% | NA |
| All Japonica | 1512 | 59.40% | 8.00% | 1.26% | 31.35% | NA |
| Aus | 269 | 64.30% | 7.80% | 1.12% | 26.77% | NA |
| Indica I | 595 | 74.30% | 0.50% | 1.01% | 24.20% | NA |
| Indica II | 465 | 60.60% | 4.30% | 2.15% | 32.90% | NA |
| Indica III | 913 | 59.60% | 4.10% | 2.08% | 34.28% | NA |
| Indica Intermediate | 786 | 59.00% | 6.20% | 2.54% | 32.19% | NA |
| Temperate Japonica | 767 | 42.80% | 12.50% | 2.22% | 42.50% | NA |
| Tropical Japonica | 504 | 86.10% | 1.00% | 0.00% | 12.90% | NA |
| Japonica Intermediate | 241 | 56.40% | 8.30% | 0.83% | 34.44% | NA |
| VI/Aromatic | 96 | 41.70% | 32.30% | 1.04% | 25.00% | NA |
| Intermediate | 90 | 68.90% | 5.60% | 0.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224323955 | T -> A | LOC_Os02g40190.1 | missense_variant ; p.Leu127Gln; MODERATE | nonsynonymous_codon ; L127Q | Average:33.559; most accessible tissue: Callus, score: 84.499 | probably damaging |
2.784 |
DELETERIOUS | 0.00 |
| vg0224323955 | T -> DEL | LOC_Os02g40190.1 | N | frameshift_variant | Average:33.559; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224323955 | NA | 4.26E-06 | mr1952 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 4.34E-09 | NA | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 8.26E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 1.74E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 7.27E-06 | 2.12E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 1.81E-06 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | NA | 1.64E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 6.40E-06 | 6.05E-07 | mr1748_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 1.61E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224323955 | 9.13E-07 | NA | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |