\
| Variant ID: vg0223811221 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23811221 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.12, others allele: 0.00, population size: 177. )
GAGACCAAAGACATTAGTCCCGGCGCGAGGACTCTAGTAAGTCAATATTTTCCTTCACTAGGAAAGCACTAATCCGAGCAATTTGATCTAAGCGGTTATT[C/T]
GCCGTTCTGTACGTGCATCCTAACGCAACAGATACTAGCTAGACATCGGGACATCGCTAGTTCGCGAATGCAAACCCAGTAAAAAAAAAAAAAGGGAACG
CGTTCCCTTTTTTTTTTTTTACTGGGTTTGCATTCGCGAACTAGCGATGTCCCGATGTCTAGCTAGTATCTGTTGCGTTAGGATGCACGTACAGAACGGC[G/A]
AATAACCGCTTAGATCAAATTGCTCGGATTAGTGCTTTCCTAGTGAAGGAAAATATTGACTTACTAGAGTCCTCGCGCCGGGACTAATGTCTTTGGTCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 8.10% | 1.90% | 11.21% | NA |
| All Indica | 2759 | 74.20% | 11.00% | 2.75% | 12.03% | NA |
| All Japonica | 1512 | 94.60% | 3.80% | 0.26% | 1.39% | NA |
| Aus | 269 | 50.60% | 0.40% | 1.86% | 47.21% | NA |
| Indica I | 595 | 66.20% | 33.10% | 0.50% | 0.17% | NA |
| Indica II | 465 | 57.20% | 2.80% | 8.39% | 31.61% | NA |
| Indica III | 913 | 88.50% | 3.80% | 1.64% | 6.02% | NA |
| Indica Intermediate | 786 | 73.80% | 7.40% | 2.42% | 16.41% | NA |
| Temperate Japonica | 767 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 0.60% | 0.79% | 3.77% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 37.50% | 13.50% | 0.00% | 48.96% | NA |
| Intermediate | 90 | 82.20% | 8.90% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223811221 | C -> T | LOC_Os02g39470.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.45; most accessible tissue: Callus, score: 88.052 | N | N | N | N |
| vg0223811221 | C -> DEL | N | N | silent_mutation | Average:50.45; most accessible tissue: Callus, score: 88.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223811221 | NA | 3.46E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223811221 | NA | 1.13E-06 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223811221 | 1.56E-06 | NA | mr1364_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223811221 | NA | 3.18E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223811221 | NA | 1.63E-08 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223811221 | NA | 6.01E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |