\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223787451:

Variant ID: vg0223787451 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23787451
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTGTTTTCCCCGCAGTTAGTCTATGTCCTAATAACATTTAAATTTACCAAAGAATCTATAAAAGTGCTTGACAAACAACGAAAGAGCTTCCTATGAG[T/C]
GGGTCAGGAAAACATAATGGGCGGGAAATGCAAAGTAAACTGAAAAAGATCATGCTCACCAGTTGCCTATATATGGCGGCCTGGACGCGCTAAATCTAGA

Reverse complement sequence

TCTAGATTTAGCGCGTCCAGGCCGCCATATATAGGCAACTGGTGAGCATGATCTTTTTCAGTTTACTTTGCATTTCCCGCCCATTATGTTTTCCTGACCC[A/G]
CTCATAGGAAGCTCTTTCGTTGTTTGTCAAGCACTTTTATAGATTCTTTGGTAAATTTAAATGTTATTAGGACATAGACTAACTGCGGGGAAAACACTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 10.20% 2.96% 0.00% NA
All Indica  2759 97.10% 1.40% 1.52% 0.00% NA
All Japonica  1512 65.90% 27.70% 6.35% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 91.10% 4.50% 4.37% 0.00% NA
Indica II  465 98.30% 1.10% 0.65% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 0.80% 1.65% 0.00% NA
Temperate Japonica  767 42.40% 49.30% 8.34% 0.00% NA
Tropical Japonica  504 93.10% 3.60% 3.37% 0.00% NA
Japonica Intermediate  241 84.20% 9.50% 6.22% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223787451 T -> C LOC_Os02g39420.1 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:52.621; most accessible tissue: Callus, score: 78.844 N N N N
vg0223787451 T -> C LOC_Os02g39430.1 downstream_gene_variant ; 1484.0bp to feature; MODIFIER silent_mutation Average:52.621; most accessible tissue: Callus, score: 78.844 N N N N
vg0223787451 T -> C LOC_Os02g39440.1 downstream_gene_variant ; 4208.0bp to feature; MODIFIER silent_mutation Average:52.621; most accessible tissue: Callus, score: 78.844 N N N N
vg0223787451 T -> C LOC_Os02g39420-LOC_Os02g39430 intergenic_region ; MODIFIER silent_mutation Average:52.621; most accessible tissue: Callus, score: 78.844 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223787451 NA 1.99E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 1.34E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 3.95E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 5.42E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 2.17E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 4.67E-09 mr1977 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 7.31E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 9.94E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 7.03E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 3.80E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 1.53E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223787451 NA 2.31E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251