\
| Variant ID: vg0223787451 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23787451 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 254. )
TCAGTGTTTTCCCCGCAGTTAGTCTATGTCCTAATAACATTTAAATTTACCAAAGAATCTATAAAAGTGCTTGACAAACAACGAAAGAGCTTCCTATGAG[T/C]
GGGTCAGGAAAACATAATGGGCGGGAAATGCAAAGTAAACTGAAAAAGATCATGCTCACCAGTTGCCTATATATGGCGGCCTGGACGCGCTAAATCTAGA
TCTAGATTTAGCGCGTCCAGGCCGCCATATATAGGCAACTGGTGAGCATGATCTTTTTCAGTTTACTTTGCATTTCCCGCCCATTATGTTTTCCTGACCC[A/G]
CTCATAGGAAGCTCTTTCGTTGTTTGTCAAGCACTTTTATAGATTCTTTGGTAAATTTAAATGTTATTAGGACATAGACTAACTGCGGGGAAAACACTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 10.20% | 2.96% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 1.40% | 1.52% | 0.00% | NA |
| All Japonica | 1512 | 65.90% | 27.70% | 6.35% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 4.50% | 4.37% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.10% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 0.80% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 42.40% | 49.30% | 8.34% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 3.60% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 9.50% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 20.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223787451 | T -> C | LOC_Os02g39420.1 | upstream_gene_variant ; 1518.0bp to feature; MODIFIER | silent_mutation | Average:52.621; most accessible tissue: Callus, score: 78.844 | N | N | N | N |
| vg0223787451 | T -> C | LOC_Os02g39430.1 | downstream_gene_variant ; 1484.0bp to feature; MODIFIER | silent_mutation | Average:52.621; most accessible tissue: Callus, score: 78.844 | N | N | N | N |
| vg0223787451 | T -> C | LOC_Os02g39440.1 | downstream_gene_variant ; 4208.0bp to feature; MODIFIER | silent_mutation | Average:52.621; most accessible tissue: Callus, score: 78.844 | N | N | N | N |
| vg0223787451 | T -> C | LOC_Os02g39420-LOC_Os02g39430 | intergenic_region ; MODIFIER | silent_mutation | Average:52.621; most accessible tissue: Callus, score: 78.844 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223787451 | NA | 1.99E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 1.34E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 3.95E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 5.42E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 2.17E-07 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 4.67E-09 | mr1977 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 7.31E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 9.94E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 7.03E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 3.80E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 1.53E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223787451 | NA | 2.31E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |