\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223511164:

Variant ID: vg0223511164 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23511164
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGTGCAAGATTTTGTCACGCTGTGGAAAGAAAATGAGAAAGTTGACATTGTTGATTCACTGAGAGGTGTGTTATTGTAGTATTCGTGCGTGTATTTT[T/G]
GTCCACTCTTAAGAATGATTCTTGATCCATGCATATACTTTTTTTTCTTTTTTTTTTAACCTTGATGGAAGGAACGTTGAATGATTTGTTGGTTTTTGCG

Reverse complement sequence

CGCAAAAACCAACAAATCATTCAACGTTCCTTCCATCAAGGTTAAAAAAAAAAGAAAAAAAAGTATATGCATGGATCAAGAATCATTCTTAAGAGTGGAC[A/C]
AAAATACACGCACGAATACTACAATAACACACCTCTCAGTGAATCAACAATGTCAACTTTCTCATTTTCTTTCCACAGCGTGACAAAATCTTGCACACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 43.10% 0.11% 0.00% NA
All Indica  2759 68.10% 31.80% 0.14% 0.00% NA
All Japonica  1512 29.00% 71.00% 0.00% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 50.10% 49.90% 0.00% 0.00% NA
Indica II  465 61.30% 38.50% 0.22% 0.00% NA
Indica III  913 84.30% 15.70% 0.00% 0.00% NA
Indica Intermediate  786 66.90% 32.70% 0.38% 0.00% NA
Temperate Japonica  767 19.60% 80.40% 0.00% 0.00% NA
Tropical Japonica  504 44.20% 55.80% 0.00% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223511164 T -> G LOC_Os02g38880.1 upstream_gene_variant ; 2114.0bp to feature; MODIFIER silent_mutation Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 N N N N
vg0223511164 T -> G LOC_Os02g38890.1 upstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 N N N N
vg0223511164 T -> G LOC_Os02g38870.1 downstream_gene_variant ; 3445.0bp to feature; MODIFIER silent_mutation Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 N N N N
vg0223511164 T -> G LOC_Os02g38900.1 downstream_gene_variant ; 3385.0bp to feature; MODIFIER silent_mutation Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 N N N N
vg0223511164 T -> G LOC_Os02g38880-LOC_Os02g38890 intergenic_region ; MODIFIER silent_mutation Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223511164 1.70E-06 1.70E-06 mr1555 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164 NA 1.89E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164 NA 4.96E-06 mr1882 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164 NA 3.90E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164 NA 3.50E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251