\
| Variant ID: vg0223511164 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23511164 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 93. )
TGGTGTGCAAGATTTTGTCACGCTGTGGAAAGAAAATGAGAAAGTTGACATTGTTGATTCACTGAGAGGTGTGTTATTGTAGTATTCGTGCGTGTATTTT[T/G]
GTCCACTCTTAAGAATGATTCTTGATCCATGCATATACTTTTTTTTCTTTTTTTTTTAACCTTGATGGAAGGAACGTTGAATGATTTGTTGGTTTTTGCG
CGCAAAAACCAACAAATCATTCAACGTTCCTTCCATCAAGGTTAAAAAAAAAAGAAAAAAAAGTATATGCATGGATCAAGAATCATTCTTAAGAGTGGAC[A/C]
AAAATACACGCACGAATACTACAATAACACACCTCTCAGTGAATCAACAATGTCAACTTTCTCATTTTCTTTCCACAGCGTGACAAAATCTTGCACACCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 43.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 68.10% | 31.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 50.10% | 49.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 61.30% | 38.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 66.90% | 32.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 19.60% | 80.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.20% | 55.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 73.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223511164 | T -> G | LOC_Os02g38880.1 | upstream_gene_variant ; 2114.0bp to feature; MODIFIER | silent_mutation | Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 | N | N | N | N |
| vg0223511164 | T -> G | LOC_Os02g38890.1 | upstream_gene_variant ; 1988.0bp to feature; MODIFIER | silent_mutation | Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 | N | N | N | N |
| vg0223511164 | T -> G | LOC_Os02g38870.1 | downstream_gene_variant ; 3445.0bp to feature; MODIFIER | silent_mutation | Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 | N | N | N | N |
| vg0223511164 | T -> G | LOC_Os02g38900.1 | downstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 | N | N | N | N |
| vg0223511164 | T -> G | LOC_Os02g38880-LOC_Os02g38890 | intergenic_region ; MODIFIER | silent_mutation | Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223511164 | 1.70E-06 | 1.70E-06 | mr1555 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223511164 | NA | 1.89E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223511164 | NA | 4.96E-06 | mr1882 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223511164 | NA | 3.90E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223511164 | NA | 3.50E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |