\
| Variant ID: vg0223422604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23422604 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGCGCCTAGCTAACATCGTCAGATCCCAATCCCCCAATCCATCGTCAAGTTCGAATTCCAACTTCAAGTCCCCTCCAAATCAAATCTCTCGACAGAAGT[C/T]
TATTTCGCCTCCCTAAAGTTTTGTGGGCCGAGCTCCCTCCCTCGGCACATCTTCTCCCTCAGCCCATCCCCTCCTCTCGCACATGCCGTGCGAGTGCGCT
AGCGCACTCGCACGGCATGTGCGAGAGGAGGGGATGGGCTGAGGGAGAAGATGTGCCGAGGGAGGGAGCTCGGCCCACAAAACTTTAGGGAGGCGAAATA[G/A]
ACTTCTGTCGAGAGATTTGATTTGGAGGGGACTTGAAGTTGGAATTCGAACTTGACGATGGATTGGGGGATTGGGATCTGACGATGTTAGCTAGGCGCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 29.30% | 2.75% | 35.23% | NA |
| All Indica | 2759 | 53.20% | 8.90% | 3.30% | 34.61% | NA |
| All Japonica | 1512 | 3.20% | 71.00% | 1.26% | 24.60% | NA |
| Aus | 269 | 1.90% | 3.70% | 6.69% | 87.73% | NA |
| Indica I | 595 | 64.00% | 7.20% | 1.51% | 27.23% | NA |
| Indica II | 465 | 65.20% | 13.10% | 4.95% | 16.77% | NA |
| Indica III | 913 | 35.30% | 7.70% | 3.40% | 53.67% | NA |
| Indica Intermediate | 786 | 58.70% | 9.20% | 3.56% | 28.63% | NA |
| Temperate Japonica | 767 | 2.50% | 79.50% | 0.91% | 17.08% | NA |
| Tropical Japonica | 504 | 5.60% | 56.90% | 1.79% | 35.71% | NA |
| Japonica Intermediate | 241 | 0.40% | 73.00% | 1.24% | 25.31% | NA |
| VI/Aromatic | 96 | 11.50% | 12.50% | 2.08% | 73.96% | NA |
| Intermediate | 90 | 18.90% | 46.70% | 0.00% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223422604 | C -> T | LOC_Os02g38750.1 | upstream_gene_variant ; 3848.0bp to feature; MODIFIER | silent_mutation | Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0223422604 | C -> T | LOC_Os02g38770.1 | upstream_gene_variant ; 4042.0bp to feature; MODIFIER | silent_mutation | Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0223422604 | C -> T | LOC_Os02g38760.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0223422604 | C -> DEL | N | N | silent_mutation | Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223422604 | NA | 8.74E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 1.88E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 1.17E-07 | mr1250_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 3.21E-20 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 1.40E-11 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 9.35E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | 7.30E-07 | NA | mr1696_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 1.77E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 4.81E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 2.35E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 8.28E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223422604 | NA | 8.09E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |