\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223422604:

Variant ID: vg0223422604 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23422604
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCGCCTAGCTAACATCGTCAGATCCCAATCCCCCAATCCATCGTCAAGTTCGAATTCCAACTTCAAGTCCCCTCCAAATCAAATCTCTCGACAGAAGT[C/T]
TATTTCGCCTCCCTAAAGTTTTGTGGGCCGAGCTCCCTCCCTCGGCACATCTTCTCCCTCAGCCCATCCCCTCCTCTCGCACATGCCGTGCGAGTGCGCT

Reverse complement sequence

AGCGCACTCGCACGGCATGTGCGAGAGGAGGGGATGGGCTGAGGGAGAAGATGTGCCGAGGGAGGGAGCTCGGCCCACAAAACTTTAGGGAGGCGAAATA[G/A]
ACTTCTGTCGAGAGATTTGATTTGGAGGGGACTTGAAGTTGGAATTCGAACTTGACGATGGATTGGGGGATTGGGATCTGACGATGTTAGCTAGGCGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 29.30% 2.75% 35.23% NA
All Indica  2759 53.20% 8.90% 3.30% 34.61% NA
All Japonica  1512 3.20% 71.00% 1.26% 24.60% NA
Aus  269 1.90% 3.70% 6.69% 87.73% NA
Indica I  595 64.00% 7.20% 1.51% 27.23% NA
Indica II  465 65.20% 13.10% 4.95% 16.77% NA
Indica III  913 35.30% 7.70% 3.40% 53.67% NA
Indica Intermediate  786 58.70% 9.20% 3.56% 28.63% NA
Temperate Japonica  767 2.50% 79.50% 0.91% 17.08% NA
Tropical Japonica  504 5.60% 56.90% 1.79% 35.71% NA
Japonica Intermediate  241 0.40% 73.00% 1.24% 25.31% NA
VI/Aromatic  96 11.50% 12.50% 2.08% 73.96% NA
Intermediate  90 18.90% 46.70% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223422604 C -> T LOC_Os02g38750.1 upstream_gene_variant ; 3848.0bp to feature; MODIFIER silent_mutation Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0223422604 C -> T LOC_Os02g38770.1 upstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0223422604 C -> T LOC_Os02g38760.1 intron_variant ; MODIFIER silent_mutation Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0223422604 C -> DEL N N silent_mutation Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223422604 NA 8.74E-12 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 1.88E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 1.17E-07 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 3.21E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 1.40E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 9.35E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 7.30E-07 NA mr1696_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 1.77E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 4.81E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 2.35E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 8.28E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604 NA 8.09E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251