Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223422604:

Variant ID: vg0223422604 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23422604
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCGCCTAGCTAACATCGTCAGATCCCAATCCCCCAATCCATCGTCAAGTTCGAATTCCAACTTCAAGTCCCCTCCAAATCAAATCTCTCGACAGAAGT[C/T]
TATTTCGCCTCCCTAAAGTTTTGTGGGCCGAGCTCCCTCCCTCGGCACATCTTCTCCCTCAGCCCATCCCCTCCTCTCGCACATGCCGTGCGAGTGCGCT

Reverse complement sequence

AGCGCACTCGCACGGCATGTGCGAGAGGAGGGGATGGGCTGAGGGAGAAGATGTGCCGAGGGAGGGAGCTCGGCCCACAAAACTTTAGGGAGGCGAAATA[G/A]
ACTTCTGTCGAGAGATTTGATTTGGAGGGGACTTGAAGTTGGAATTCGAACTTGACGATGGATTGGGGGATTGGGATCTGACGATGTTAGCTAGGCGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.80%	29.30%	2.75%	35.23%	NA
All Indica	2759	53.20%	8.90%	3.30%	34.61%	NA
All Japonica	1512	3.20%	71.00%	1.26%	24.60%	NA
Aus	269	1.90%	3.70%	6.69%	87.73%	NA
Indica I	595	64.00%	7.20%	1.51%	27.23%	NA
Indica II	465	65.20%	13.10%	4.95%	16.77%	NA
Indica III	913	35.30%	7.70%	3.40%	53.67%	NA
Indica Intermediate	786	58.70%	9.20%	3.56%	28.63%	NA
Temperate Japonica	767	2.50%	79.50%	0.91%	17.08%	NA
Tropical Japonica	504	5.60%	56.90%	1.79%	35.71%	NA
Japonica Intermediate	241	0.40%	73.00%	1.24%	25.31%	NA
VI/Aromatic	96	11.50%	12.50%	2.08%	73.96%	NA
Intermediate	90	18.90%	46.70%	0.00%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223422604	C -> T	LOC_Os02g38750.1	upstream_gene_variant ; 3848.0bp to feature; MODIFIER	silent_mutation	Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0223422604	C -> T	LOC_Os02g38770.1	upstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0223422604	C -> T	LOC_Os02g38760.1	intron_variant ; MODIFIER	silent_mutation	Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0223422604	C -> DEL	N	N	silent_mutation	Average:55.274; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223422604	NA	8.74E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	1.88E-13	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	1.17E-07	mr1250_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	3.21E-20	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	1.40E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	9.35E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	7.30E-07	NA	mr1696_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	1.77E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	4.81E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	2.35E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	8.28E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422604	NA	8.09E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251