\
| Variant ID: vg0223419298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23419298 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 89. )
AAGGTTCTTTAATGAAGGAGCATGGCTCTTCTCTCCATCATTATTGTACAAATAACTAGCCTTCTCAGCCCTATCTGTTTGGTATAACAAAAGTGTTACA[G/A]
TGTCAGCCAAAAAAAATCACCTCATAAATTAAATTGTTATGCTTAAACATACAGATAAATCATTAAAAAAACACATGGATAAGGAAAAGATAGCCCATAA
TTATGGGCTATCTTTTCCTTATCCATGTGTTTTTTTAATGATTTATCTGTATGTTTAAGCATAACAATTTAATTTATGAGGTGATTTTTTTTGGCTGACA[C/T]
TGTAACACTTTTGTTATACCAAACAGATAGGGCTGAGAAGGCTAGTTATTTGTACAATAATGATGGAGAGAAGAGCCATGCTCCTTCATTAAAGAACCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.20% | 21.70% | 1.29% | 50.78% | NA |
| All Indica | 2759 | 3.90% | 32.80% | 1.30% | 62.02% | NA |
| All Japonica | 1512 | 70.80% | 1.50% | 0.46% | 27.18% | NA |
| Aus | 269 | 1.50% | 27.90% | 0.74% | 69.89% | NA |
| Indica I | 595 | 6.20% | 18.50% | 1.51% | 73.78% | NA |
| Indica II | 465 | 3.00% | 20.40% | 1.51% | 75.05% | NA |
| Indica III | 913 | 1.60% | 48.80% | 0.44% | 49.07% | NA |
| Indica Intermediate | 786 | 5.30% | 32.20% | 2.04% | 60.43% | NA |
| Temperate Japonica | 767 | 79.50% | 1.70% | 0.39% | 18.38% | NA |
| Tropical Japonica | 504 | 56.50% | 1.80% | 0.20% | 41.47% | NA |
| Japonica Intermediate | 241 | 73.00% | 0.40% | 1.24% | 25.31% | NA |
| VI/Aromatic | 96 | 15.60% | 12.50% | 14.58% | 57.29% | NA |
| Intermediate | 90 | 44.40% | 14.40% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223419298 | G -> A | LOC_Os02g38750.1 | upstream_gene_variant ; 542.0bp to feature; MODIFIER | silent_mutation | Average:9.312; most accessible tissue: Callus, score: 36.829 | N | N | N | N |
| vg0223419298 | G -> A | LOC_Os02g38760.1 | upstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:9.312; most accessible tissue: Callus, score: 36.829 | N | N | N | N |
| vg0223419298 | G -> A | LOC_Os02g38740.1 | downstream_gene_variant ; 2361.0bp to feature; MODIFIER | silent_mutation | Average:9.312; most accessible tissue: Callus, score: 36.829 | N | N | N | N |
| vg0223419298 | G -> A | LOC_Os02g38750-LOC_Os02g38760 | intergenic_region ; MODIFIER | silent_mutation | Average:9.312; most accessible tissue: Callus, score: 36.829 | N | N | N | N |
| vg0223419298 | G -> DEL | N | N | silent_mutation | Average:9.312; most accessible tissue: Callus, score: 36.829 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223419298 | NA | 5.43E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 6.54E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 5.95E-29 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 3.45E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | 7.14E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | 4.34E-06 | NA | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 9.49E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 3.24E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | 5.40E-07 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 5.76E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 8.51E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223419298 | NA | 4.27E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |