| Variant ID: vg0223207791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23207791 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTAACTCAATAGTCAAAAATATAATGCATCTATGAATATTACATGAAATCGGAGTCTCGAACCGACAGAGCTTCGCCTCTTCTTCTCTTCTCCTCCCCCT[T/C,A]
CTTTTTTAGAGTGGAGGTGATGGGAGGAATGAGGAGGGAGGGCTGGGCGGCAAGGGGCCTCCATGCAAAAAAGCCAGCCCAGGCCGGCCCCTTTCCACCC
GGGTGGAAAGGGGCCGGCCTGGGCTGGCTTTTTTGCATGGAGGCCCCTTGCCGCCCAGCCCTCCCTCCTCATTCCTCCCATCACCTCCACTCTAAAAAAG[A/G,T]
AGGGGGAGGAGAAGAGAAGAAGAGGCGAAGCTCTGTCGGTTCGAGACTCCGATTTCATGTAATATTCATAGATGCATTATATTTTTGACTATTGAGTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 0.10% | 4.23% | 2.77% | A: 0.04% |
| All Indica | 2759 | 92.00% | 0.10% | 5.69% | 2.25% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.60% | 0.33% | NA |
| Aus | 269 | 76.60% | 0.70% | 5.58% | 17.10% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.00% | 0.20% | 17.63% | 5.16% | NA |
| Indica III | 913 | 95.20% | 0.00% | 2.74% | 2.08% | NA |
| Indica Intermediate | 786 | 91.00% | 0.30% | 6.36% | 2.42% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 0.00% | 1.59% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 66.70% | 2.10% | 15.62% | 15.62% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 4.44% | 3.33% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223207791 | T -> A | LOC_Os02g38380.1 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> A | LOC_Os02g38386.1 | upstream_gene_variant ; 1903.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> A | LOC_Os02g38392.1 | upstream_gene_variant ; 3841.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> A | LOC_Os02g38380-LOC_Os02g38386 | intergenic_region ; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> DEL | N | N | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> C | LOC_Os02g38380.1 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> C | LOC_Os02g38386.1 | upstream_gene_variant ; 1903.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> C | LOC_Os02g38392.1 | upstream_gene_variant ; 3841.0bp to feature; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0223207791 | T -> C | LOC_Os02g38380-LOC_Os02g38386 | intergenic_region ; MODIFIER | silent_mutation | Average:84.451; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223207791 | NA | 3.11E-08 | mr1042_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | NA | 2.62E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | NA | 8.24E-07 | mr1479_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | NA | 8.36E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | NA | 1.54E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | 1.60E-06 | 2.23E-09 | mr1871_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223207791 | NA | 3.93E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |