\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223169280:

Variant ID: vg0223169280 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 23169280
Reference Allele: TAlternative Allele: G,TCG
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGATACATTTTGACAAGTTCTAGAACCTGATATGCATTTTGAGAATTTGGGGATTTAGATGACACACCGCTACAAGTTTAAGGACCGTTCGTGCACA[T/G,TCG]
TACTCTTTTTTCTTGTGGAAAAAGAGCTACTCGTTTGTGTCCCCTCCTTCCAATCTGTTGCTAACATGGCAACCTTGTAACCCCGGTTCACAAAAAACCA

Reverse complement sequence

TGGTTTTTTGTGAACCGGGGTTACAAGGTTGCCATGTTAGCAACAGATTGGAAGGAGGGGACACAAACGAGTAGCTCTTTTTCCACAAGAAAAAAGAGTA[A/C,CGA]
TGTGCACGAACGGTCCTTAAACTTGTAGCGGTGTGTCATCTAAATCCCCAAATTCTCAAAATGCATATCAGGTTCTAGAACTTGTCAAAATGTATCATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 44.60% 0.38% 3.09% NA
All Indica  2759 73.60% 25.60% 0.47% 0.29% NA
All Japonica  1512 10.40% 80.60% 0.00% 8.99% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 87.40% 12.10% 0.50% 0.00% NA
Indica II  465 73.50% 25.40% 0.65% 0.43% NA
Indica III  913 66.30% 33.00% 0.22% 0.55% NA
Indica Intermediate  786 71.90% 27.40% 0.64% 0.13% NA
Temperate Japonica  767 1.70% 98.00% 0.00% 0.26% NA
Tropical Japonica  504 27.80% 48.60% 0.00% 23.61% NA
Japonica Intermediate  241 2.10% 91.70% 0.00% 6.22% NA
VI/Aromatic  96 27.10% 70.80% 2.08% 0.00% NA
Intermediate  90 35.60% 60.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223169280 T -> G LOC_Os02g38310.1 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> G LOC_Os02g38320.1 upstream_gene_variant ; 3328.0bp to feature; MODIFIER silent_mutation Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> G LOC_Os02g38310-LOC_Os02g38320 intergenic_region ; MODIFIER silent_mutation Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> TCG LOC_Os02g38310.1 upstream_gene_variant ; 3521.0bp to feature; MODIFIER N Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> TCG LOC_Os02g38320.1 upstream_gene_variant ; 3327.0bp to feature; MODIFIER N Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> TCG LOC_Os02g38310-LOC_Os02g38320 intergenic_region ; MODIFIER N Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0223169280 T -> DEL N N silent_mutation Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223169280 NA 9.88E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 7.81E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.29E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 5.41E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.06E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 4.63E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 7.25E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 3.68E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 4.39E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 8.61E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 3.29E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 7.26E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.88E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.08E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 3.01E-06 NA mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 4.99E-06 2.82E-09 mr1795 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.06E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.58E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 5.51E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 5.22E-07 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.24E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.74E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 9.28E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.16E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 3.72E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.59E-07 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 4.97E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.68E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.55E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 3.83E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.52E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 4.66E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 1.55E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 3.08E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 2.59E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 NA 8.18E-06 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 6.02E-06 NA mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 3.37E-06 5.45E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280 2.79E-06 3.51E-08 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251