Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223169280:

Variant ID: vg0223169280 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 23169280
Reference Allele: T	Alternative Allele: G,TCG
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

AGATGATACATTTTGACAAGTTCTAGAACCTGATATGCATTTTGAGAATTTGGGGATTTAGATGACACACCGCTACAAGTTTAAGGACCGTTCGTGCACA[T/G,TCG]
TACTCTTTTTTCTTGTGGAAAAAGAGCTACTCGTTTGTGTCCCCTCCTTCCAATCTGTTGCTAACATGGCAACCTTGTAACCCCGGTTCACAAAAAACCA

Reverse complement sequence

TGGTTTTTTGTGAACCGGGGTTACAAGGTTGCCATGTTAGCAACAGATTGGAAGGAGGGGACACAAACGAGTAGCTCTTTTTCCACAAGAAAAAAGAGTA[A/C,CGA]
TGTGCACGAACGGTCCTTAAACTTGTAGCGGTGTGTCATCTAAATCCCCAAATTCTCAAAATGCATATCAGGTTCTAGAACTTGTCAAAATGTATCATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	44.60%	0.38%	3.09%	NA
All Indica	2759	73.60%	25.60%	0.47%	0.29%	NA
All Japonica	1512	10.40%	80.60%	0.00%	8.99%	NA
Aus	269	76.20%	23.40%	0.37%	0.00%	NA
Indica I	595	87.40%	12.10%	0.50%	0.00%	NA
Indica II	465	73.50%	25.40%	0.65%	0.43%	NA
Indica III	913	66.30%	33.00%	0.22%	0.55%	NA
Indica Intermediate	786	71.90%	27.40%	0.64%	0.13%	NA
Temperate Japonica	767	1.70%	98.00%	0.00%	0.26%	NA
Tropical Japonica	504	27.80%	48.60%	0.00%	23.61%	NA
Japonica Intermediate	241	2.10%	91.70%	0.00%	6.22%	NA
VI/Aromatic	96	27.10%	70.80%	2.08%	0.00%	NA
Intermediate	90	35.60%	60.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223169280	T -> G	LOC_Os02g38310.1	upstream_gene_variant ; 3520.0bp to feature; MODIFIER	silent_mutation	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> G	LOC_Os02g38320.1	upstream_gene_variant ; 3328.0bp to feature; MODIFIER	silent_mutation	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> G	LOC_Os02g38310-LOC_Os02g38320	intergenic_region ; MODIFIER	silent_mutation	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> TCG	LOC_Os02g38310.1	upstream_gene_variant ; 3521.0bp to feature; MODIFIER	N	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> TCG	LOC_Os02g38320.1	upstream_gene_variant ; 3327.0bp to feature; MODIFIER	N	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> TCG	LOC_Os02g38310-LOC_Os02g38320	intergenic_region ; MODIFIER	N	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0223169280	T -> DEL	N	N	silent_mutation	Average:58.378; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223169280	NA	9.88E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	7.81E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.29E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	5.41E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.06E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	4.63E-08	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	7.25E-08	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	3.68E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	4.39E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	8.61E-16	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	3.29E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	7.26E-15	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.88E-07	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.08E-07	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	3.01E-06	NA	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	4.99E-06	2.82E-09	mr1795	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.06E-08	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.58E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	5.51E-07	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	5.22E-07	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.24E-07	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.74E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	9.28E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.16E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	3.72E-07	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.59E-07	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	4.97E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.68E-07	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.55E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	3.83E-08	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.52E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	4.66E-06	mr1239_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	1.55E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	3.08E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	2.59E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	NA	8.18E-06	mr1911_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	6.02E-06	NA	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	3.37E-06	5.45E-07	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223169280	2.79E-06	3.51E-08	mr1929_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251