\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223104206:

Variant ID: vg0223104206 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23104206
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTACAAATAAGTAAATATTAATTGTACATTTTAAAACTGAAGAATTTATAATTGTATAGATTAATTACCTTATTTAAGGGTATTAAACCTATTTTTCA[G/A]
TTTGTTTGGTTTGAGGACAAATAAGATGGGATGATCCATGACACAGAATATTCCCCTAAGACCAAGATCAAGTTAGCCTAGTCCCTTAGAAATTGGCGGA

Reverse complement sequence

TCCGCCAATTTCTAAGGGACTAGGCTAACTTGATCTTGGTCTTAGGGGAATATTCTGTGTCATGGATCATCCCATCTTATTTGTCCTCAAACCAAACAAA[C/T]
TGAAAAATAGGTTTAATACCCTTAAATAAGGTAATTAATCTATACAATTATAAATTCTTCAGTTTTAAAATGTACAATTAATATTTACTTATTTGTAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.80% 0.06% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 85.40% 14.40% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 88.50% 11.30% 0.13% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 72.20% 27.00% 0.83% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223104206 G -> A LOC_Os02g38180.1 upstream_gene_variant ; 1462.0bp to feature; MODIFIER silent_mutation Average:71.668; most accessible tissue: Callus, score: 89.305 N N N N
vg0223104206 G -> A LOC_Os02g38190.1 downstream_gene_variant ; 1334.0bp to feature; MODIFIER silent_mutation Average:71.668; most accessible tissue: Callus, score: 89.305 N N N N
vg0223104206 G -> A LOC_Os02g38200.1 downstream_gene_variant ; 2725.0bp to feature; MODIFIER silent_mutation Average:71.668; most accessible tissue: Callus, score: 89.305 N N N N
vg0223104206 G -> A LOC_Os02g38180-LOC_Os02g38190 intergenic_region ; MODIFIER silent_mutation Average:71.668; most accessible tissue: Callus, score: 89.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223104206 1.16E-13 NA mr1334 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 1.11E-07 NA mr1334 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 8.78E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 1.45E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 5.37E-06 1.26E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 NA 1.20E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 NA 2.05E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 NA 9.51E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 5.06E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 NA 4.04E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 1.54E-12 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 7.70E-06 NA mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104206 NA 4.45E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251