\
| Variant ID: vg0223104206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23104206 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACTACAAATAAGTAAATATTAATTGTACATTTTAAAACTGAAGAATTTATAATTGTATAGATTAATTACCTTATTTAAGGGTATTAAACCTATTTTTCA[G/A]
TTTGTTTGGTTTGAGGACAAATAAGATGGGATGATCCATGACACAGAATATTCCCCTAAGACCAAGATCAAGTTAGCCTAGTCCCTTAGAAATTGGCGGA
TCCGCCAATTTCTAAGGGACTAGGCTAACTTGATCTTGGTCTTAGGGGAATATTCTGTGTCATGGATCATCCCATCTTATTTGTCCTCAAACCAAACAAA[C/T]
TGAAAAATAGGTTTAATACCCTTAAATAAGGTAATTAATCTATACAATTATAAATTCTTCAGTTTTAAAATGTACAATTAATATTTACTTATTTGTAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.40% | 14.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.50% | 11.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 27.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223104206 | G -> A | LOC_Os02g38180.1 | upstream_gene_variant ; 1462.0bp to feature; MODIFIER | silent_mutation | Average:71.668; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0223104206 | G -> A | LOC_Os02g38190.1 | downstream_gene_variant ; 1334.0bp to feature; MODIFIER | silent_mutation | Average:71.668; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0223104206 | G -> A | LOC_Os02g38200.1 | downstream_gene_variant ; 2725.0bp to feature; MODIFIER | silent_mutation | Average:71.668; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0223104206 | G -> A | LOC_Os02g38180-LOC_Os02g38190 | intergenic_region ; MODIFIER | silent_mutation | Average:71.668; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223104206 | 1.16E-13 | NA | mr1334 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 1.11E-07 | NA | mr1334 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 8.78E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 1.45E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 5.37E-06 | 1.26E-07 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | NA | 1.20E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | NA | 2.05E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | NA | 9.51E-07 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 5.06E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | NA | 4.04E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 1.54E-12 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | 7.70E-06 | NA | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223104206 | NA | 4.45E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |