\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222988287:

Variant ID: vg0222988287 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22988287
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGTGTTCGCCACAGCGGAGCGATATATTAGCACATGATTAATTAAGTATTTACTATTTTTTAAAAAAATAGATCAATATGATTTTTTAAGTAACTTT[C/T]
GTATATAAATATTTTTTTAAAAAAATACTGTTTAGCAGTTTGAAAAGCATGCGCGAAAAATAATGAGTGAGGGGTTGGTGCCGAACACATCCGCACCGGG

Reverse complement sequence

CCCGGTGCGGATGTGTTCGGCACCAACCCCTCACTCATTATTTTTCGCGCATGCTTTTCAAACTGCTAAACAGTATTTTTTTAAAAAAATATTTATATAC[G/A]
AAAGTTACTTAAAAAATCATATTGATCTATTTTTTTAAAAAATAGTAAATACTTAATTAATCATGTGCTAATATATCGCTCCGCTGTGGCGAACACACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.40% 0.15% 0.02% NA
All Indica  2759 91.70% 8.00% 0.22% 0.04% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 53.90% 46.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 80.40% 18.50% 0.86% 0.22% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222988287 C -> T LOC_Os02g38050.1 upstream_gene_variant ; 691.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38060.1 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050.4 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050.3 upstream_gene_variant ; 691.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050.5 upstream_gene_variant ; 691.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050.6 upstream_gene_variant ; 691.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050.2 upstream_gene_variant ; 691.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38060.2 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> T LOC_Os02g38050-LOC_Os02g38060 intergenic_region ; MODIFIER silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N
vg0222988287 C -> DEL N N silent_mutation Average:97.024; most accessible tissue: Minghui63 root, score: 98.714 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222988287 C T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222988287 NA 3.65E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 1.28E-06 3.96E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 2.99E-08 1.04E-20 mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 8.32E-08 2.27E-17 mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 2.05E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 1.04E-07 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 2.91E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 2.62E-07 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 5.70E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 5.38E-07 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 3.45E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 1.24E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 3.29E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 5.90E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 1.06E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 9.44E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 3.28E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 6.37E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 1.22E-06 8.70E-19 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 5.74E-07 3.95E-21 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 9.01E-07 1.79E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 3.96E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 2.67E-06 2.06E-18 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 1.44E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 2.03E-09 7.26E-24 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 NA 9.23E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222988287 2.17E-09 3.89E-19 mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251