\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222959216:

Variant ID: vg0222959216 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22959216
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGATCGTCGAGTAGCCGCAAGCGTCGACCACGCAAGTGGGAGAAGGCGCGTAGTGGCACTCTTGGCGGCGCCGATGGCGAGCGCAAGGGCAGCCGCGAC[A/G]
ACACCTGCCACAACTGCGGGAAGACCGGCCACTGGGCCAAGGACTGCCGGCAGGCGACGCACGGCGGTCAAGCACACGTCGCTCAAGCGCTGGAGGGTGA

Reverse complement sequence

TCACCCTCCAGCGCTTGAGCGACGTGTGCTTGACCGCCGTGCGTCGCCTGCCGGCAGTCCTTGGCCCAGTGGCCGGTCTTCCCGCAGTTGTGGCAGGTGT[T/C]
GTCGCGGCTGCCCTTGCGCTCGCCATCGGCGCCGCCAAGAGTGCCACTACGCGCCTTCTCCCACTTGCGTGGTCGACGCTTGCGGCTACTCGACGATCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 4.50% 0.78% 0.89% NA
All Indica  2759 94.80% 2.50% 1.27% 1.45% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 48.00% 50.60% 0.74% 0.74% NA
Indica I  595 95.30% 0.00% 2.02% 2.69% NA
Indica II  465 95.90% 1.70% 1.29% 1.08% NA
Indica III  913 93.00% 4.40% 1.31% 1.31% NA
Indica Intermediate  786 95.80% 2.70% 0.64% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222959216 A -> G LOC_Os02g38000.1 missense_variant ; p.Asn478Asp; MODERATE nonsynonymous_codon Average:65.022; most accessible tissue: Zhenshan97 young leaf, score: 77.101 unknown unknown TOLERATED 1.00
vg0222959216 A -> DEL LOC_Os02g38000.1 N frameshift_variant Average:65.022; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222959216 2.53E-06 1.33E-19 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 3.85E-08 7.66E-26 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 9.91E-08 1.38E-21 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.08E-10 1.10E-30 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 2.74E-07 1.30E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 4.88E-06 2.53E-21 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 2.03E-07 2.79E-30 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 2.28E-06 1.06E-18 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 8.61E-06 2.26E-23 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.13E-06 1.24E-24 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 6.36E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 2.64E-10 1.16E-27 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.30E-07 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.51E-06 3.69E-20 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 6.82E-10 1.81E-23 mr1961 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.91E-07 2.16E-25 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 5.97E-07 3.44E-28 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 5.05E-09 9.30E-30 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.28E-06 3.83E-18 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 5.60E-08 6.32E-29 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 4.62E-06 3.43E-27 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 4.17E-07 1.51E-32 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.81E-06 2.09E-22 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.46E-07 6.38E-29 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 9.51E-06 4.50E-30 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 1.76E-09 2.99E-26 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222959216 NA 3.39E-18 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251