\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222952563:

Variant ID: vg0222952563 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22952563
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTCCGTTCCATTTAAAATGCATTTATAGATTTCTGTGTTCAACGTTTAACCGTTCATCTTATTTAAAAAAATTAAAAAAAATAATTAGTACTATTCAT[A/G]
TTTTATTATCTAATAACAATAAAAAAATATTAATTATAAAAAATCAAATAAAATGGACGGTCAGACGATATGGAACCTATTACTACACTTAATATAGGAC

Reverse complement sequence

GTCCTATATTAAGTGTAGTAATAGGTTCCATATCGTCTGACCGTCCATTTTATTTGATTTTTTATAATTAATATTTTTTTATTGTTATTAGATAATAAAA[T/C]
ATGAATAGTACTAATTATTTTTTTTAATTTTTTTAAATAAGATGAACGGTTAAACGTTGAACACAGAAATCTATAAATGCATTTTAAATGGAACGGAGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 14.00% 5.06% 0.40% NA
All Indica  2759 91.30% 4.30% 4.39% 0.04% NA
All Japonica  1512 66.60% 25.10% 7.21% 1.12% NA
Aus  269 45.40% 53.50% 1.12% 0.00% NA
Indica I  595 88.90% 0.00% 10.92% 0.17% NA
Indica II  465 94.00% 1.90% 4.09% 0.00% NA
Indica III  913 91.70% 8.10% 0.22% 0.00% NA
Indica Intermediate  786 91.10% 4.50% 4.45% 0.00% NA
Temperate Japonica  767 83.80% 3.70% 10.43% 2.09% NA
Tropical Japonica  504 42.10% 55.20% 2.78% 0.00% NA
Japonica Intermediate  241 63.10% 30.30% 6.22% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 20.00% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222952563 A -> G LOC_Os02g37990.1 downstream_gene_variant ; 3023.0bp to feature; MODIFIER silent_mutation Average:66.817; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg0222952563 A -> G LOC_Os02g37970-LOC_Os02g37990 intergenic_region ; MODIFIER silent_mutation Average:66.817; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg0222952563 A -> DEL N N silent_mutation Average:66.817; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222952563 A G -0.01 0.02 0.02 0.01 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222952563 2.44E-13 NA mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 7.54E-08 NA mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 5.04E-13 1.57E-19 mr1117 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.32E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.46E-09 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 9.43E-07 NA mr1120 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 1.82E-08 NA mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.31E-10 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 2.73E-09 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 9.46E-10 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.29E-10 6.61E-16 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 NA 5.97E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 1.02E-08 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 1.58E-07 NA mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 8.00E-10 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 2.16E-09 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 2.01E-13 1.64E-19 mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 6.50E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.93E-10 NA mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.94E-08 NA mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 1.52E-08 NA mr1123_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 2.58E-08 NA mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 1.16E-08 NA mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 4.30E-09 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222952563 3.40E-12 2.70E-15 mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251