\
| Variant ID: vg0222830353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22830353 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTACGGATAAAAAGTGAAAGATAGGAGACAAAAGTATATCACAAGTGAAATAGCAAAAACCATTAATTTAATCTTACATATAGGTACTCCCTCCGTCCCA[C/T]
AATATAAGGGATTTTGAGTTTTTTGTTTGTAACGTTTTACCACTCATTTTATTCAAATTTTTTTTTGCAAATATAAAAAAATAAAAAATTGTACTTAAAG
CTTTAAGTACAATTTTTTATTTTTTTATATTTGCAAAAAAAAATTTGAATAAAATGAGTGGTAAAACGTTACAAACAAAAAACTCAAAATCCCTTATATT[G/A]
TGGGACGGAGGGAGTACCTATATGTAAGATTAAATTAATGGTTTTTGCTATTTCACTTGTGATATACTTTTGTCTCCTATCTTTCACTTTTTATCCGTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 4.10% | 3.11% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.20% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 12.20% | 8.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.20% | 2.02% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 66.90% | 19.70% | 13.43% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 13.70% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222830353 | C -> T | LOC_Os02g37830.1 | upstream_gene_variant ; 4133.0bp to feature; MODIFIER | silent_mutation | Average:51.639; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0222830353 | C -> T | LOC_Os02g37830.2 | upstream_gene_variant ; 4133.0bp to feature; MODIFIER | silent_mutation | Average:51.639; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0222830353 | C -> T | LOC_Os02g37830-LOC_Os02g37834 | intergenic_region ; MODIFIER | silent_mutation | Average:51.639; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222830353 | 8.19E-10 | NA | mr1210 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 3.96E-06 | 1.02E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 3.90E-10 | NA | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 9.38E-07 | 1.05E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 3.54E-06 | 3.54E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 8.26E-10 | 9.52E-09 | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 3.52E-07 | 2.08E-12 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 8.22E-13 | NA | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 1.42E-07 | 8.82E-11 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 1.26E-06 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | NA | 1.36E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 1.77E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | NA | 5.09E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | 6.02E-07 | 1.34E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222830353 | NA | 2.47E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |