Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222674849:

Variant ID: vg0222674849 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22674849
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAAAATGTAGCGCTCGCCCATTAATATCGGTCATTCCTAAGAGCTAATAATATAGCCGATTTGTTGGCTATAAGGTTATTTGTATCATTCTCTTATC[T/C]
TATCCATATAATAGTTAGCTCTTCACAATTAATACAGGGCCCACTTGTCTCTCTCACAGAGTTTCTTGGTTATTGTGTCCAAGCCGGCTGTAAGTTTACA

Reverse complement sequence

TGTAAACTTACAGCCGGCTTGGACACAATAACCAAGAAACTCTGTGAGAGAGACAAGTGGGCCCTGTATTAATTGTGAAGAGCTAACTATTATATGGATA[A/G]
GATAAGAGAATGATACAAATAACCTTATAGCCAACAAATCGGCTATATTATTAGCTCTTAGGAATGACCGATATTAATGGGCGAGCGCTACATTTTTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 23.10% 0.02% 1.31% NA
All Indica  2759 90.90% 6.90% 0.04% 2.21% NA
All Japonica  1512 45.70% 54.30% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 92.20% 2.50% 0.00% 5.26% NA
Indica Intermediate  786 90.10% 8.30% 0.00% 1.65% NA
Temperate Japonica  767 20.90% 79.10% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222674849 T -> DEL N N silent_mutation Average:58.021; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg0222674849 T -> C LOC_Os02g37580.1 upstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:58.021; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg0222674849 T -> C LOC_Os02g37580-LOC_Os02g37590 intergenic_region ; MODIFIER silent_mutation Average:58.021; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222674849 NA 1.86E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 4.20E-06 4.40E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 8.42E-06 3.27E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 NA 4.35E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 NA 9.80E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 7.89E-06 NA mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 5.92E-06 NA mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 2.83E-06 NA mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 1.85E-06 NA mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 6.43E-06 NA mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 6.83E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 1.58E-09 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 5.58E-10 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 3.66E-08 NA mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 3.24E-08 NA mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 5.08E-08 NA mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 7.00E-08 NA mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 NA 7.12E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 1.61E-06 9.15E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 NA 9.77E-06 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 1.06E-07 1.12E-06 mr1918_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 1.98E-06 6.36E-06 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222674849 3.10E-07 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251