\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222663599:

Variant ID: vg0222663599 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22663599
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTATCTGCTTGAATAAGTTTGGGCGTGCATATATATATGTACGTCTCAGTCTGTGTGTGCCGGGTAGTTATTCCCAATTAAGTGCGTTTAGTTTTACC[A/G]
GTAATTTGTATGGTGTGTACTCGTGTGTTCTCGTAGTGTATTGTAAGTGGATCACGTGTGCTATTTATGAATAATAAAAGGGGCGGTGGAGCAACGTGAT

Reverse complement sequence

ATCACGTTGCTCCACCGCCCCTTTTATTATTCATAAATAGCACACGTGATCCACTTACAATACACTACGAGAACACACGAGTACACACCATACAAATTAC[T/C]
GGTAAAACTAAACGCACTTAATTGGGAATAACTACCCGGCACACACAGACTGAGACGTACATATATATATGCACGCCCAAACTTATTCAAGCAGATAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 20.80% 0.83% 0.00% NA
All Indica  2759 94.60% 5.10% 0.25% 0.00% NA
All Japonica  1512 50.10% 48.10% 1.85% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 88.20% 11.10% 0.67% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.60% 0.25% 0.00% NA
Temperate Japonica  767 71.30% 26.50% 2.22% 0.00% NA
Tropical Japonica  504 19.00% 79.20% 1.79% 0.00% NA
Japonica Intermediate  241 47.30% 51.90% 0.83% 0.00% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 66.70% 30.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222663599 A -> G LOC_Os02g37560.1 downstream_gene_variant ; 3544.0bp to feature; MODIFIER silent_mutation Average:65.007; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0222663599 A -> G LOC_Os02g37570.1 downstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:65.007; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0222663599 A -> G LOC_Os02g37580.1 downstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:65.007; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0222663599 A -> G LOC_Os02g37570-LOC_Os02g37580 intergenic_region ; MODIFIER silent_mutation Average:65.007; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222663599 5.50E-06 NA mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 1.86E-06 9.63E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 NA 9.18E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 NA 6.31E-06 mr1882 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 9.21E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 4.07E-08 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 3.73E-08 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 2.40E-06 NA mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 7.22E-07 NA mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 1.18E-06 NA mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 7.29E-06 NA mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 NA 5.07E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 5.90E-06 NA mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222663599 3.00E-06 NA mr1918_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251