Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222652666:

Variant ID: vg0222652666 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22652666
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCCCGTGTTCAAACAAGTTCCTAAAGTTTTCTCACGTAGTTCAATATAGTCCTTAGAAGAAAAACAGTGAGACCACGTGAACATGCCTACTGCCCACT[G/A]
CTACAGAACCCCCTGTAGGTGATGGCTCATATGAACCCCCTACGTGCCTACATGCATATGTGTCGGTTCAATTGGAATTTGAACCGACACCTATAATATA

Reverse complement sequence

TATATTATAGGTGTCGGTTCAAATTCCAATTGAACCGACACATATGCATGTAGGCACGTAGGGGGTTCATATGAGCCATCACCTACAGGGGGTTCTGTAG[C/T]
AGTGGGCAGTAGGCATGTTCACGTGGTCTCACTGTTTTTCTTCTAAGGACTATATTGAACTACGTGAGAAAACTTTAGGAACTTGTTTGAACACGGGGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.10%	23.50%	0.25%	0.13%	NA
All Indica	2759	93.00%	6.60%	0.14%	0.22%	NA
All Japonica	1512	45.60%	54.00%	0.40%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	83.20%	16.00%	0.34%	0.50%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.40%	2.50%	0.00%	0.11%	NA
Indica Intermediate	786	91.50%	8.00%	0.25%	0.25%	NA
Temperate Japonica	767	21.30%	78.20%	0.52%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	45.20%	53.90%	0.83%	0.00%	NA
VI/Aromatic	96	16.70%	82.30%	1.04%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222652666	G -> A	LOC_Os02g37530.1	upstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:40.451; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0222652666	G -> A	LOC_Os02g37550.1	upstream_gene_variant ; 2844.0bp to feature; MODIFIER	silent_mutation	Average:40.451; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0222652666	G -> A	LOC_Os02g37540.1	downstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:40.451; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0222652666	G -> A	LOC_Os02g37540-LOC_Os02g37550	intergenic_region ; MODIFIER	silent_mutation	Average:40.451; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0222652666	G -> DEL	N	N	silent_mutation	Average:40.451; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222652666	4.61E-06	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	1.23E-07	NA	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	1.32E-07	NA	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	4.05E-06	NA	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	3.32E-06	NA	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	2.44E-06	NA	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	8.45E-07	NA	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652666	2.42E-06	NA	mr1929_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251