\
| Variant ID: vg0222624216 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22624216 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )
TATTTTTTTTGGAGGAACTGGTCAATCAAGATGGTCGGAAAAATTATAGAAGAATCTTTGACCATCGGTTGTGACATGGCATAAGATTTTCCTTTTGTAG[T/C]
TTTCGGTTGTATTTTTGCTCGTTCTACGCTATGGACCGCAAAAGAGATGGTTTGGGCCTTCATTTGGTCCATGTGTCCTACGTTACATCTGTCTTTCCGC
GCGGAAAGACAGATGTAACGTAGGACACATGGACCAAATGAAGGCCCAAACCATCTCTTTTGCGGTCCATAGCGTAGAACGAGCAAAAATACAACCGAAA[A/G]
CTACAAAAGGAAAATCTTATGCCATGTCACAACCGATGGTCAAAGATTCTTCTATAATTTTTCCGACCATCTTGATTGACCAGTTCCTCCAAAAAAAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222624216 | T -> C | LOC_Os02g37490.1 | upstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:44.462; most accessible tissue: Callus, score: 81.069 | N | N | N | N |
| vg0222624216 | T -> C | LOC_Os02g37470.1 | downstream_gene_variant ; 4111.0bp to feature; MODIFIER | silent_mutation | Average:44.462; most accessible tissue: Callus, score: 81.069 | N | N | N | N |
| vg0222624216 | T -> C | LOC_Os02g37480.1 | downstream_gene_variant ; 1028.0bp to feature; MODIFIER | silent_mutation | Average:44.462; most accessible tissue: Callus, score: 81.069 | N | N | N | N |
| vg0222624216 | T -> C | LOC_Os02g37480-LOC_Os02g37490 | intergenic_region ; MODIFIER | silent_mutation | Average:44.462; most accessible tissue: Callus, score: 81.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222624216 | 3.49E-06 | NA | mr1077 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 5.76E-07 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 1.06E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 5.73E-06 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 1.95E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 5.81E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 3.82E-08 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 5.26E-07 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 6.41E-17 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 2.22E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 2.96E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 8.37E-07 | 2.35E-21 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 6.91E-07 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 1.15E-06 | 1.65E-19 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 3.49E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 9.49E-07 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | 4.12E-06 | 3.56E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 8.68E-15 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222624216 | NA | 6.16E-08 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |