Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222624216:

Variant ID: vg0222624216 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22624216
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTTTTTGGAGGAACTGGTCAATCAAGATGGTCGGAAAAATTATAGAAGAATCTTTGACCATCGGTTGTGACATGGCATAAGATTTTCCTTTTGTAG[T/C]
TTTCGGTTGTATTTTTGCTCGTTCTACGCTATGGACCGCAAAAGAGATGGTTTGGGCCTTCATTTGGTCCATGTGTCCTACGTTACATCTGTCTTTCCGC

Reverse complement sequence

GCGGAAAGACAGATGTAACGTAGGACACATGGACCAAATGAAGGCCCAAACCATCTCTTTTGCGGTCCATAGCGTAGAACGAGCAAAAATACAACCGAAA[A/G]
CTACAAAAGGAAAATCTTATGCCATGTCACAACCGATGGTCAAAGATTCTTCTATAATTTTTCCGACCATCTTGATTGACCAGTTCCTCCAAAAAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	6.10%	0.00%	0.00%	NA
All Indica	2759	96.10%	3.90%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	37.90%	62.10%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222624216	T -> C	LOC_Os02g37490.1	upstream_gene_variant ; 2056.0bp to feature; MODIFIER	silent_mutation	Average:44.462; most accessible tissue: Callus, score: 81.069	N	N	N	N
vg0222624216	T -> C	LOC_Os02g37470.1	downstream_gene_variant ; 4111.0bp to feature; MODIFIER	silent_mutation	Average:44.462; most accessible tissue: Callus, score: 81.069	N	N	N	N
vg0222624216	T -> C	LOC_Os02g37480.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:44.462; most accessible tissue: Callus, score: 81.069	N	N	N	N
vg0222624216	T -> C	LOC_Os02g37480-LOC_Os02g37490	intergenic_region ; MODIFIER	silent_mutation	Average:44.462; most accessible tissue: Callus, score: 81.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222624216	3.49E-06	NA	mr1077	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	5.76E-07	NA	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	1.06E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	5.73E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	1.95E-16	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	5.81E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	3.82E-08	NA	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	5.26E-07	NA	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	6.41E-17	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	2.22E-17	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	2.96E-18	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	8.37E-07	2.35E-21	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	6.91E-07	NA	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	1.15E-06	1.65E-19	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	3.49E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	9.49E-07	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	4.12E-06	3.56E-15	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	8.68E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624216	NA	6.16E-08	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251