\
| Variant ID: vg0222623248 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22623248 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 268. )
GTACTTCTAATACCACTAGCTACTAAAAATGCATATAAAGATCGACGCTATAGGGTACCAAAACAGCTAAAACTAACACCTATAGTGCGTTTCTCTCCTT[C/T]
ACGAGTTAAGAACACATAAAACAGGCATCTATACATGTGCAAGGTTTCTGGTGTAGTAGGACTCGTACTGTGCGCAAGACGATGTGCTGGGGAGAAACAG
CTGTTTCTCCCCAGCACATCGTCTTGCGCACAGTACGAGTCCTACTACACCAGAAACCTTGCACATGTATAGATGCCTGTTTTATGTGTTCTTAACTCGT[G/A]
AAGGAGAGAAACGCACTATAGGTGTTAGTTTTAGCTGTTTTGGTACCCTATAGCGTCGATCTTTATATGCATTTTTAGTAGCTAGTGGTATTAGAAGTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222623248 | C -> T | LOC_Os02g37490.1 | upstream_gene_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:71.204; most accessible tissue: Callus, score: 96.086 | N | N | N | N |
| vg0222623248 | C -> T | LOC_Os02g37470.1 | downstream_gene_variant ; 3143.0bp to feature; MODIFIER | silent_mutation | Average:71.204; most accessible tissue: Callus, score: 96.086 | N | N | N | N |
| vg0222623248 | C -> T | LOC_Os02g37480.1 | downstream_gene_variant ; 60.0bp to feature; MODIFIER | silent_mutation | Average:71.204; most accessible tissue: Callus, score: 96.086 | N | N | N | N |
| vg0222623248 | C -> T | LOC_Os02g37480-LOC_Os02g37490 | intergenic_region ; MODIFIER | silent_mutation | Average:71.204; most accessible tissue: Callus, score: 96.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222623248 | 8.52E-06 | NA | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 7.18E-06 | NA | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 9.84E-08 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | NA | 3.00E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 8.83E-06 | NA | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 7.84E-08 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 1.26E-07 | NA | mr1099_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 4.89E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 2.71E-08 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 5.51E-06 | 1.12E-17 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | NA | 8.74E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | 7.34E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | NA | 2.67E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222623248 | NA | 3.21E-08 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |