Variant ID: vg0222613010 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22613010 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
TCCCGATGTTCCGGTGTACTTTGAAATAGTCGTCGAGGTTCCTCCAGGAGCATAGCAAGGCAAGTCATGCTTGTCACTTGAACATATTGATCCTATATTG[C/T]
AAATGCTCTATCATTTTCCTTTAAGTACTGCATCATTTTATAATGTTACTGCTCTATCGTTTTTCACTTGAACATGTTTTCCTTTAAGTACGGCCAGTGA
TCACTGGCCGTACTTAAAGGAAAACATGTTCAAGTGAAAAACGATAGAGCAGTAACATTATAAAATGATGCAGTACTTAAAGGAAAATGATAGAGCATTT[G/A]
CAATATAGGATCAATATGTTCAAGTGACAAGCATGACTTGCCTTGCTATGCTCCTGGAGGAACCTCGACGACTATTTCAAAGTACACCGGAACATCGGGA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 52.90% | 46.70% | 0.17% | 0.25% | NA |
All Indica | 2759 | 84.00% | 15.40% | 0.18% | 0.36% | NA |
All Japonica | 1512 | 3.40% | 96.30% | 0.13% | 0.13% | NA |
Aus | 269 | 36.40% | 63.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 80.80% | 18.20% | 0.50% | 0.50% | NA |
Indica II | 465 | 92.50% | 6.90% | 0.22% | 0.43% | NA |
Indica III | 913 | 85.20% | 14.70% | 0.00% | 0.11% | NA |
Indica Intermediate | 786 | 80.00% | 19.30% | 0.13% | 0.51% | NA |
Temperate Japonica | 767 | 0.70% | 99.10% | 0.13% | 0.13% | NA |
Tropical Japonica | 504 | 8.50% | 91.10% | 0.20% | 0.20% | NA |
Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222613010 | C -> T | LOC_Os02g37450.1 | upstream_gene_variant ; 927.0bp to feature; MODIFIER | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0222613010 | C -> T | LOC_Os02g37460.1 | upstream_gene_variant ; 1281.0bp to feature; MODIFIER | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0222613010 | C -> T | LOC_Os02g37470.1 | upstream_gene_variant ; 4493.0bp to feature; MODIFIER | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0222613010 | C -> T | LOC_Os02g37440.1 | downstream_gene_variant ; 3802.0bp to feature; MODIFIER | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0222613010 | C -> T | LOC_Os02g37450-LOC_Os02g37460 | intergenic_region ; MODIFIER | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0222613010 | C -> DEL | N | N | silent_mutation | Average:40.629; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222613010 | 1.24E-06 | 4.25E-15 | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222613010 | NA | 2.44E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222613010 | NA | 8.39E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222613010 | 3.43E-06 | 1.27E-15 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222613010 | NA | 3.26E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |