\
| Variant ID: vg0222050955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22050955 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCAGAAATAGTCCTTTTTGGGGCGCCAGAGTGGCTAGCGCCGTCATCAACGGGACGGCGCCAGCCTCTCTGGCGCCGTCCTCCTGCCACCGTGGCGCACG[C/T]
GAACCGACGTGGCAGGAGGAGGGCGCCAGCATGGCTAGCGCTGCCCCAGGGAGGAGGGCGCCAGCATGGCTGGCGCCACCGCCTCCATTCCTGTTTTTCT
AGAAAAACAGGAATGGAGGCGGTGGCGCCAGCCATGCTGGCGCCCTCCTCCCTGGGGCAGCGCTAGCCATGCTGGCGCCCTCCTCCTGCCACGTCGGTTC[G/A]
CGTGCGCCACGGTGGCAGGAGGACGGCGCCAGAGAGGCTGGCGCCGTCCCGTTGATGACGGCGCTAGCCACTCTGGCGCCCCAAAAAGGACTATTTCTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 7.10% | 6.20% | 9.01% | NA |
| All Indica | 2759 | 64.30% | 11.90% | 9.10% | 14.72% | NA |
| All Japonica | 1512 | 98.30% | 0.30% | 0.93% | 0.53% | NA |
| Aus | 269 | 90.70% | 0.70% | 8.55% | 0.00% | NA |
| Indica I | 595 | 51.80% | 16.10% | 14.29% | 17.82% | NA |
| Indica II | 465 | 51.80% | 3.70% | 11.83% | 32.69% | NA |
| Indica III | 913 | 75.00% | 17.40% | 4.27% | 3.29% | NA |
| Indica Intermediate | 786 | 68.60% | 7.30% | 9.16% | 15.01% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 96.20% | 0.60% | 2.18% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 2.20% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222050955 | C -> T | LOC_Os02g36500.1 | upstream_gene_variant ; 4055.0bp to feature; MODIFIER | silent_mutation | Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0222050955 | C -> T | LOC_Os02g36505.1 | downstream_gene_variant ; 2983.0bp to feature; MODIFIER | silent_mutation | Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0222050955 | C -> T | LOC_Os02g36500-LOC_Os02g36505 | intergenic_region ; MODIFIER | silent_mutation | Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0222050955 | C -> DEL | N | N | silent_mutation | Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222050955 | NA | 1.22E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 6.12E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 6.53E-07 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 2.85E-06 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 2.08E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 4.24E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | 1.17E-06 | 8.04E-12 | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | 6.96E-06 | 7.08E-09 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222050955 | NA | 8.93E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |