\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222050955:

Variant ID: vg0222050955 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22050955
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGAAATAGTCCTTTTTGGGGCGCCAGAGTGGCTAGCGCCGTCATCAACGGGACGGCGCCAGCCTCTCTGGCGCCGTCCTCCTGCCACCGTGGCGCACG[C/T]
GAACCGACGTGGCAGGAGGAGGGCGCCAGCATGGCTAGCGCTGCCCCAGGGAGGAGGGCGCCAGCATGGCTGGCGCCACCGCCTCCATTCCTGTTTTTCT

Reverse complement sequence

AGAAAAACAGGAATGGAGGCGGTGGCGCCAGCCATGCTGGCGCCCTCCTCCCTGGGGCAGCGCTAGCCATGCTGGCGCCCTCCTCCTGCCACGTCGGTTC[G/A]
CGTGCGCCACGGTGGCAGGAGGACGGCGCCAGAGAGGCTGGCGCCGTCCCGTTGATGACGGCGCTAGCCACTCTGGCGCCCCAAAAAGGACTATTTCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 7.10% 6.20% 9.01% NA
All Indica  2759 64.30% 11.90% 9.10% 14.72% NA
All Japonica  1512 98.30% 0.30% 0.93% 0.53% NA
Aus  269 90.70% 0.70% 8.55% 0.00% NA
Indica I  595 51.80% 16.10% 14.29% 17.82% NA
Indica II  465 51.80% 3.70% 11.83% 32.69% NA
Indica III  913 75.00% 17.40% 4.27% 3.29% NA
Indica Intermediate  786 68.60% 7.30% 9.16% 15.01% NA
Temperate Japonica  767 99.60% 0.10% 0.13% 0.13% NA
Tropical Japonica  504 96.20% 0.60% 2.18% 0.99% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 80.00% 2.20% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222050955 C -> T LOC_Os02g36500.1 upstream_gene_variant ; 4055.0bp to feature; MODIFIER silent_mutation Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0222050955 C -> T LOC_Os02g36505.1 downstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0222050955 C -> T LOC_Os02g36500-LOC_Os02g36505 intergenic_region ; MODIFIER silent_mutation Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0222050955 C -> DEL N N silent_mutation Average:21.105; most accessible tissue: Minghui63 root, score: 35.002 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222050955 NA 1.22E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 6.12E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 6.53E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 2.85E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 2.08E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 4.24E-06 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 1.17E-06 8.04E-12 mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 6.96E-06 7.08E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222050955 NA 8.93E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251