Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222037003:

Variant ID: vg0222037003 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22037003
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.42, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAATACGTTTAAAATAGAGTCAACAAATATTTCAAAAATATGATCCACACATAAACATTCGCAATAAAAGTTCAAACAAGATTAAACAACATGCCCGCGC[A/G]
TACGCGCGGGCTACCTTCCTAGTTTTTATAATAAGTACATATACATATTAGACTAGTGACCAATCTATAAGTGCTTGTTGCTATTTTTAGAAGCTAAAGG

Reverse complement sequence

CCTTTAGCTTCTAAAAATAGCAACAAGCACTTATAGATTGGTCACTAGTCTAATATGTATATGTACTTATTATAAAAACTAGGAAGGTAGCCCGCGCGTA[T/C]
GCGCGGGCATGTTGTTTAATCTTGTTTGAACTTTTATTGCGAATGTTTATGTGTGGATCATATTTTTGAAATATTTGTTGACTCTATTTTAAACGTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.20% 0.59% 0.00% NA
All Indica  2759 95.20% 4.00% 0.87% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 69.50% 30.10% 0.37% 0.00% NA
Indica I  595 95.80% 3.70% 0.50% 0.00% NA
Indica II  465 95.10% 4.50% 0.43% 0.00% NA
Indica III  913 94.20% 4.80% 0.99% 0.00% NA
Indica Intermediate  786 95.90% 2.80% 1.27% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222037003 A -> G LOC_Os02g36480.1 downstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:42.422; most accessible tissue: Callus, score: 60.857 N N N N
vg0222037003 A -> G LOC_Os02g36490.1 downstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:42.422; most accessible tissue: Callus, score: 60.857 N N N N
vg0222037003 A -> G LOC_Os02g36490.2 downstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:42.422; most accessible tissue: Callus, score: 60.857 N N N N
vg0222037003 A -> G LOC_Os02g36490.3 downstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:42.422; most accessible tissue: Callus, score: 60.857 N N N N
vg0222037003 A -> G LOC_Os02g36480-LOC_Os02g36490 intergenic_region ; MODIFIER silent_mutation Average:42.422; most accessible tissue: Callus, score: 60.857 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222037003 1.21E-06 1.21E-06 mr1384 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251