| Variant ID: vg0222021907 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 22021907 |
| Reference Allele: TGA | Alternative Allele: CGA,T |
| Primary Allele: CGA | Secondary Allele: TGA |
Inferred Ancestral Allele: Not determined.
TATCTAGTGCGCCCGTACCATTTGGTCTTATCTAGCGGCCCTTTCGTAAACCATCTGATCAGTTGATGATGGAGATGGAGAAATGATTTGGCTAGTTCTA[TGA/CGA,T]
GGTGGTGGGCTAGCCGGTCCGAATTCAAAACTCCGTTCCTTTTATTTATTTGATGTTAGATCATTCTCTAATATTCGTGTTTTAGTTGGTGATGGATAGC
GCTATCCATCACCAACTAAAACACGAATATTAGAGAATGATCTAACATCAAATAAATAAAAGGAACGGAGTTTTGAATTCGGACCGGCTAGCCCACCACC[TCA/TCG,A]
TAGAACTAGCCAAATCATTTCTCCATCTCCATCATCAACTGATCAGATGGTTTACGAAAGGGCCGCTAGATAAGACCAAATGGTACGGGCGCACTAGATA
| Populations | Population Size | Frequency of CGA(primary allele) | Frequency of TGA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.80% | 36.80% | 0.44% | 0.00% | T: 0.02% |
| All Indica | 2759 | 91.40% | 7.90% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 84.50% | 13.90% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 1.11% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222021907 | TGA -> T | LOC_Os02g36470.1 | upstream_gene_variant ; 4171.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> T | LOC_Os02g36450.1 | downstream_gene_variant ; 4261.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> T | LOC_Os02g36460.1 | downstream_gene_variant ; 930.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> T | LOC_Os02g36450.2 | downstream_gene_variant ; 4263.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> T | LOC_Os02g36460-LOC_Os02g36470 | intergenic_region ; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> CGA | LOC_Os02g36470.1 | upstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> CGA | LOC_Os02g36450.1 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> CGA | LOC_Os02g36460.1 | downstream_gene_variant ; 929.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> CGA | LOC_Os02g36450.2 | downstream_gene_variant ; 4262.0bp to feature; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| vg0222021907 | TGA -> CGA | LOC_Os02g36460-LOC_Os02g36470 | intergenic_region ; MODIFIER | silent_mutation | Average:79.988; most accessible tissue: Callus, score: 90.787 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222021907 | NA | 6.09E-08 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0222021907 | NA | 5.32E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.48E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.47E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 4.54E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 5.22E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 1.35E-29 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.80E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | 3.44E-06 | 3.44E-06 | mr1449 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 6.05E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.92E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | 5.45E-06 | NA | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.81E-06 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 2.05E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 3.01E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 3.71E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222021907 | NA | 5.76E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |