\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222021907:

Variant ID: vg0222021907 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22021907
Reference Allele: TGAAlternative Allele: CGA,T
Primary Allele: CGASecondary Allele: TGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCTAGTGCGCCCGTACCATTTGGTCTTATCTAGCGGCCCTTTCGTAAACCATCTGATCAGTTGATGATGGAGATGGAGAAATGATTTGGCTAGTTCTA[TGA/CGA,T]
GGTGGTGGGCTAGCCGGTCCGAATTCAAAACTCCGTTCCTTTTATTTATTTGATGTTAGATCATTCTCTAATATTCGTGTTTTAGTTGGTGATGGATAGC

Reverse complement sequence

GCTATCCATCACCAACTAAAACACGAATATTAGAGAATGATCTAACATCAAATAAATAAAAGGAACGGAGTTTTGAATTCGGACCGGCTAGCCCACCACC[TCA/TCG,A]
TAGAACTAGCCAAATCATTTCTCCATCTCCATCATCAACTGATCAGATGGTTTACGAAAGGGCCGCTAGATAAGACCAAATGGTACGGGCGCACTAGATA

Allele Frequencies:

Populations Population SizeFrequency of CGA(primary allele) Frequency of TGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.80% 0.44% 0.00% T: 0.02%
All Indica  2759 91.40% 7.90% 0.72% 0.00% NA
All Japonica  1512 8.10% 91.90% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 96.30% 3.40% 0.34% 0.00% NA
Indica II  465 98.50% 1.10% 0.43% 0.00% NA
Indica III  913 90.50% 9.20% 0.33% 0.00% NA
Indica Intermediate  786 84.50% 13.90% 1.65% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 1.11% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222021907 TGA -> T LOC_Os02g36470.1 upstream_gene_variant ; 4171.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> T LOC_Os02g36450.1 downstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> T LOC_Os02g36460.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> T LOC_Os02g36450.2 downstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> T LOC_Os02g36460-LOC_Os02g36470 intergenic_region ; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> CGA LOC_Os02g36470.1 upstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> CGA LOC_Os02g36450.1 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> CGA LOC_Os02g36460.1 downstream_gene_variant ; 929.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> CGA LOC_Os02g36450.2 downstream_gene_variant ; 4262.0bp to feature; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N
vg0222021907 TGA -> CGA LOC_Os02g36460-LOC_Os02g36470 intergenic_region ; MODIFIER silent_mutation Average:79.988; most accessible tissue: Callus, score: 90.787 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222021907 NA 6.09E-08 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222021907 NA 5.32E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.48E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.47E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 4.54E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 5.22E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 1.35E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.80E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 3.44E-06 3.44E-06 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 6.05E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.92E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 5.45E-06 NA mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.81E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 2.05E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 3.01E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 3.71E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021907 NA 5.76E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251