Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221993684:

Variant ID: vg0221993684 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21993684
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAATATCAACGCTCGTCAGATATATATATATATATATATATATATATATATATATATATATATATATATATATATGCTTTATATGTGTGTTAAAATT[C/T]
ATATGGATATTATTGAATCTATACGAGAAATCAAGAGACCAGAACGTATGTTGAACGGAGGGAGTACTTTCTTTCGGGTTTCGGCTATGAGCCTATGAAT

Reverse complement sequence

ATTCATAGGCTCATAGCCGAAACCCGAAAGAAAGTACTCCCTCCGTTCAACATACGTTCTGGTCTCTTGATTTCTCGTATAGATTCAATAATATCCATAT[G/A]
AATTTTAACACACATATAAAGCATATATATATATATATATATATATATATATATATATATATATATATATATATATATCTGACGAGCGTTGATATTTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.60% 0.60% 1.93% 52.86% NA
All Indica  2759 20.50% 1.00% 2.90% 75.57% NA
All Japonica  1512 92.50% 0.00% 0.20% 7.34% NA
Aus  269 3.00% 0.00% 1.86% 95.17% NA
Indica I  595 20.30% 0.50% 0.84% 78.32% NA
Indica II  465 5.80% 0.60% 4.95% 88.60% NA
Indica III  913 24.90% 1.60% 3.29% 70.21% NA
Indica Intermediate  786 24.30% 0.90% 2.80% 72.01% NA
Temperate Japonica  767 98.70% 0.00% 0.26% 1.04% NA
Tropical Japonica  504 81.90% 0.00% 0.00% 18.06% NA
Japonica Intermediate  241 94.60% 0.00% 0.41% 4.98% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 53.30% 1.10% 3.33% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221993684 C -> T LOC_Os02g36400.1 upstream_gene_variant ; 2265.0bp to feature; MODIFIER silent_mutation Average:55.422; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0221993684 C -> T LOC_Os02g36414.1 upstream_gene_variant ; 1692.0bp to feature; MODIFIER silent_mutation Average:55.422; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0221993684 C -> T LOC_Os02g36400-LOC_Os02g36414 intergenic_region ; MODIFIER silent_mutation Average:55.422; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0221993684 C -> DEL N N silent_mutation Average:55.422; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221993684 C T 0.02 0.02 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221993684 NA 9.62E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221993684 6.82E-06 6.82E-06 mr1556 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 NA 3.40E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 3.27E-07 3.27E-07 mr1764 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 NA 2.50E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 NA 7.34E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 NA 2.19E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221993684 NA 2.35E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251