\
| Variant ID: vg0221853596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21853596 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 336. )
CTTTTTCCCCTGAATCACTGGAAATGCATTTCCTCTTATGTGTGTGTGTGTATGTTTTATCCACTTCACACTGTTTTGCAGGACTGAAAAGAGTAGTTGT[A/G]
TACATTACAAGCAACTTATTTCATACTTACGAGTAAAACGTTGAACGTTTGAATACACTACATGCTTTCTAGACCAAGAATTATTGAGTGATAGACATTA
TAATGTCTATCACTCAATAATTCTTGGTCTAGAAAGCATGTAGTGTATTCAAACGTTCAACGTTTTACTCGTAAGTATGAAATAAGTTGCTTGTAATGTA[T/C]
ACAACTACTCTTTTCAGTCCTGCAAAACAGTGTGAAGTGGATAAAACATACACACACACACATAAGAGGAAATGCATTTCCAGTGATTCAGGGGAAAAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.40% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 4.10% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.10% | 18.70% | 3.23% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221853596 | A -> G | LOC_Os02g36220.1 | 3_prime_UTR_variant ; 206.0bp to feature; MODIFIER | silent_mutation | Average:31.972; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| vg0221853596 | A -> G | LOC_Os02g36220.2 | 3_prime_UTR_variant ; 206.0bp to feature; MODIFIER | silent_mutation | Average:31.972; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221853596 | NA | 4.61E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 3.07E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 4.00E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 2.48E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | 1.31E-06 | 1.77E-08 | mr1076 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | 7.90E-07 | NA | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | 1.69E-06 | 1.38E-10 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 1.15E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 6.59E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 4.12E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 4.00E-08 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 3.36E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 3.53E-06 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221853596 | NA | 5.59E-06 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |