Variant ID: vg0221815577 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 21815577 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATATTCAAATAAGTATAGACATTTCACCCATAGTAAACCATAGGCAATTTGTTAGTAGTTCAAAAGATATATTCTGAAACCGTTAAAAAAATATCACTA[C/T]
TAGAGAAACTCTCATCTCTCCCGGTTTGCAATCCCCTGTAGTCCCGGGTTACAAACAAAGAGAGAGAATCCAGGACTAAAAATGGCGATCTTTAGTCCGG
CCGGACTAAAGATCGCCATTTTTAGTCCTGGATTCTCTCTCTTTGTTTGTAACCCGGGACTACAGGGGATTGCAAACCGGGAGAGATGAGAGTTTCTCTA[G/A]
TAGTGATATTTTTTTAACGGTTTCAGAATATATCTTTTGAACTACTAACAAATTGCCTATGGTTTACTATGGGTGAAATGTCTATACTTATTTGAATATA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.20% | 5.70% | 1.10% | 0.00% | NA |
All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 86.80% | 10.00% | 3.17% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 97.90% | 0.30% | 1.83% | 0.00% | NA |
Tropical Japonica | 504 | 73.80% | 23.00% | 3.17% | 0.00% | NA |
Japonica Intermediate | 241 | 78.80% | 13.70% | 7.47% | 0.00% | NA |
VI/Aromatic | 96 | 12.50% | 84.40% | 3.12% | 0.00% | NA |
Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0221815577 | C -> T | LOC_Os02g36190.1 | upstream_gene_variant ; 2117.0bp to feature; MODIFIER | silent_mutation | Average:38.054; most accessible tissue: Callus, score: 58.262 | N | N | N | N |
vg0221815577 | C -> T | LOC_Os02g36190-LOC_Os02g36200 | intergenic_region ; MODIFIER | silent_mutation | Average:38.054; most accessible tissue: Callus, score: 58.262 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0221815577 | 1.99E-08 | NA | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0221815577 | 8.04E-08 | NA | mr1042_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0221815577 | NA | 9.53E-06 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0221815577 | 1.15E-06 | NA | mr1742_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0221815577 | 1.19E-10 | NA | mr1871_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0221815577 | 4.00E-08 | NA | mr1871_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |