\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221761822:

Variant ID: vg0221761822 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21761822
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAATATTATTATATATGTTTTTTATAAACTTAGTAGTTCAATAAAAAAAATCATAGCAATTTATAATATGAAACTTAAGGAATATCCAGTAGGTGAGTT[C/T]
ATACTCGATCAGCATTGGGCATGGAGAACTACCGAATGAAGTAGATAGAGTAGTTCATATAGCTCTCGTTCGATCGCTGCTTCTTCCTCCTGCCTGCCTT

Reverse complement sequence

AAGGCAGGCAGGAGGAAGAAGCAGCGATCGAACGAGAGCTATATGAACTACTCTATCTACTTCATTCGGTAGTTCTCCATGCCCAATGCTGATCGAGTAT[G/A]
AACTCACCTACTGGATATTCCTTAAGTTTCATATTATAAATTGCTATGATTTTTTTTATTGAACTACTAAGTTTATAAAAAACATATATAATAATATTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.60% 0.36% 0.00% NA
All Indica  2759 97.50% 2.20% 0.25% 0.00% NA
All Japonica  1512 8.20% 91.40% 0.40% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 98.00% 1.80% 0.22% 0.00% NA
Indica Intermediate  786 95.50% 4.10% 0.38% 0.00% NA
Temperate Japonica  767 1.40% 98.20% 0.39% 0.00% NA
Tropical Japonica  504 19.60% 80.20% 0.20% 0.00% NA
Japonica Intermediate  241 5.80% 93.40% 0.83% 0.00% NA
VI/Aromatic  96 11.50% 86.50% 2.08% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221761822 C -> T LOC_Os02g36140.2 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0221761822 C -> T LOC_Os02g36140.5 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0221761822 C -> T LOC_Os02g36140.4 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0221761822 C -> T LOC_Os02g36140.3 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0221761822 C -> T LOC_Os02g36130-LOC_Os02g36140 intergenic_region ; MODIFIER silent_mutation Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221761822 NA 2.09E-12 mr1714 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 1.04E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 1.24E-55 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 2.49E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 1.27E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 7.82E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 2.16E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 1.15E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 7.65E-63 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 6.21E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 6.17E-08 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221761822 NA 8.56E-11 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251