| Variant ID: vg0221761822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21761822 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGAATATTATTATATATGTTTTTTATAAACTTAGTAGTTCAATAAAAAAAATCATAGCAATTTATAATATGAAACTTAAGGAATATCCAGTAGGTGAGTT[C/T]
ATACTCGATCAGCATTGGGCATGGAGAACTACCGAATGAAGTAGATAGAGTAGTTCATATAGCTCTCGTTCGATCGCTGCTTCTTCCTCCTGCCTGCCTT
AAGGCAGGCAGGAGGAAGAAGCAGCGATCGAACGAGAGCTATATGAACTACTCTATCTACTTCATTCGGTAGTTCTCCATGCCCAATGCTGATCGAGTAT[G/A]
AACTCACCTACTGGATATTCCTTAAGTTTCATATTATAAATTGCTATGATTTTTTTTATTGAACTACTAAGTTTATAAAAAACATATATAATAATATTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.60% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.20% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 8.20% | 91.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 4.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 19.60% | 80.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 93.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 86.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 52.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221761822 | C -> T | LOC_Os02g36140.2 | upstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0221761822 | C -> T | LOC_Os02g36140.5 | upstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0221761822 | C -> T | LOC_Os02g36140.4 | upstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0221761822 | C -> T | LOC_Os02g36140.3 | upstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0221761822 | C -> T | LOC_Os02g36130-LOC_Os02g36140 | intergenic_region ; MODIFIER | silent_mutation | Average:36.64; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221761822 | NA | 2.09E-12 | mr1714 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 1.04E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 1.24E-55 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 2.49E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 1.27E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 7.82E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 2.16E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 1.15E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 7.65E-63 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 6.21E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 6.17E-08 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221761822 | NA | 8.56E-11 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |