\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221741384:

Variant ID: vg0221741384 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21741384
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGCTGCTCCACAACCCGGCCATCATGGCGAGGGTGCGCGCGGAGCTGAGCGACGTGCTCGGCGGGAAGGAGGCCGTGGAGGAGGCCGACGCGGCGAGG[C/T]
TGCCCTACCTCCAGGCCGTGCTGAAGGAGGCCATGAGGCTGCACCCGGTGGGCGCGCTGCTGCTGCCGCACTTCGCCGCGGAGGACGGCGTGGAGATCGG

Reverse complement sequence

CCGATCTCCACGCCGTCCTCCGCGGCGAAGTGCGGCAGCAGCAGCGCGCCCACCGGGTGCAGCCTCATGGCCTCCTTCAGCACGGCCTGGAGGTAGGGCA[G/A]
CCTCGCCGCGTCGGCCTCCTCCACGGCCTCCTTCCCGCCGAGCACGTCGCTCAGCTCCGCGCGCACCCTCGCCATGATGGCCGGGTTGTGGAGCAGCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.10% 0.21% 0.51% NA
All Indica  2759 77.60% 21.50% 0.29% 0.62% NA
All Japonica  1512 7.70% 92.00% 0.07% 0.20% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 92.10% 7.20% 0.50% 0.17% NA
Indica II  465 71.40% 27.50% 0.22% 0.86% NA
Indica III  913 75.60% 23.70% 0.22% 0.55% NA
Indica Intermediate  786 72.80% 26.10% 0.25% 0.89% NA
Temperate Japonica  767 1.00% 98.70% 0.13% 0.13% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 94.60% 0.00% 0.83% NA
VI/Aromatic  96 9.40% 89.60% 0.00% 1.04% NA
Intermediate  90 36.70% 58.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221741384 C -> T LOC_Os02g36110.1 synonymous_variant ; p.Leu347Leu; LOW synonymous_codon Average:79.17; most accessible tissue: Minghui63 young leaf, score: 88.874 N N N N
vg0221741384 C -> DEL LOC_Os02g36110.1 N frameshift_variant Average:79.17; most accessible tissue: Minghui63 young leaf, score: 88.874 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221741384 C T -0.02 -0.03 -0.04 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221741384 NA 1.79E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 5.13E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 2.93E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 4.38E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 9.58E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 1.22E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 8.92E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 8.67E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 8.48E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 3.17E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 1.22E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 6.30E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 4.60E-25 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 2.98E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 2.27E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 2.58E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 2.00E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 1.86E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 1.78E-08 mr1915_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221741384 NA 1.29E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251