\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221533352:

Variant ID: vg0221533352 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21533352
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGACTCAGATACGGATATGTATTTTCAAAAGTAAATAAACTTAAAAACCGACTAATACACGGATGACGTATCAAAATACCGACAAAAACATCTTCA[G/A,C]
TTTTTATAATAGTAGAGATATGGCGATCTAAATTTTTGTTTGGTTTGTATATATATGATGACCAAATTTCTTGTTTGGTTGGAGGGATATAGTATGGATG

Reverse complement sequence

CATCCATACTATATCCCTCCAACCAAACAAGAAATTTGGTCATCATATATATACAAACCAAACAAAAATTTAGATCGCCATATCTCTACTATTATAAAAA[C/T,G]
TGAAGATGTTTTTGTCGGTATTTTGATACGTCATCCGTGTATTAGTCGGTTTTTAAGTTTATTTACTTTTGAAAATACATATCCGTATCTGAGTCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.40% 0.21% 0.06% C: 0.06%
All Indica  2759 38.60% 60.90% 0.33% 0.11% C: 0.04%
All Japonica  1512 96.60% 3.40% 0.00% 0.00% NA
Aus  269 27.90% 72.10% 0.00% 0.00% NA
Indica I  595 16.60% 82.70% 0.50% 0.17% NA
Indica II  465 46.70% 52.90% 0.22% 0.22% NA
Indica III  913 49.70% 50.10% 0.11% 0.11% NA
Indica Intermediate  786 37.50% 61.80% 0.51% 0.00% C: 0.13%
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 92.70% 7.30% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 1.11% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221533352 G -> A LOC_Os02g35840.1 upstream_gene_variant ; 544.0bp to feature; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> A LOC_Os02g35830.1 downstream_gene_variant ; 4375.0bp to feature; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> A LOC_Os02g35840-LOC_Os02g35860 intergenic_region ; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> DEL N N silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> C LOC_Os02g35840.1 upstream_gene_variant ; 544.0bp to feature; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> C LOC_Os02g35830.1 downstream_gene_variant ; 4375.0bp to feature; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0221533352 G -> C LOC_Os02g35840-LOC_Os02g35860 intergenic_region ; MODIFIER silent_mutation Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221533352 NA 6.37E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 4.11E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 3.22E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 5.18E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 6.84E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 7.36E-08 mr1461 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 4.92E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 1.61E-09 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 2.06E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 5.88E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 1.83E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 1.69E-07 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 2.13E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 9.33E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 1.95E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 3.32E-06 3.32E-06 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352 NA 1.59E-06 mr1911_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251