Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221533352:

Variant ID: vg0221533352 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21533352
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGACTCAGATACGGATATGTATTTTCAAAAGTAAATAAACTTAAAAACCGACTAATACACGGATGACGTATCAAAATACCGACAAAAACATCTTCA[G/A,C]
TTTTTATAATAGTAGAGATATGGCGATCTAAATTTTTGTTTGGTTTGTATATATATGATGACCAAATTTCTTGTTTGGTTGGAGGGATATAGTATGGATG

Reverse complement sequence

CATCCATACTATATCCCTCCAACCAAACAAGAAATTTGGTCATCATATATATACAAACCAAACAAAAATTTAGATCGCCATATCTCTACTATTATAAAAA[C/T,G]
TGAAGATGTTTTTGTCGGTATTTTGATACGTCATCCGTGTATTAGTCGGTTTTTAAGTTTATTTACTTTTGAAAATACATATCCGTATCTGAGTCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.40%	0.21%	0.06%	C: 0.06%
All Indica	2759	38.60%	60.90%	0.33%	0.11%	C: 0.04%
All Japonica	1512	96.60%	3.40%	0.00%	0.00%	NA
Aus	269	27.90%	72.10%	0.00%	0.00%	NA
Indica I	595	16.60%	82.70%	0.50%	0.17%	NA
Indica II	465	46.70%	52.90%	0.22%	0.22%	NA
Indica III	913	49.70%	50.10%	0.11%	0.11%	NA
Indica Intermediate	786	37.50%	61.80%	0.51%	0.00%	C: 0.13%
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	92.70%	7.30%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	22.20%	1.11%	0.00%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221533352	G -> A	LOC_Os02g35840.1	upstream_gene_variant ; 544.0bp to feature; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> A	LOC_Os02g35830.1	downstream_gene_variant ; 4375.0bp to feature; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> A	LOC_Os02g35840-LOC_Os02g35860	intergenic_region ; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> DEL	N	N	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> C	LOC_Os02g35840.1	upstream_gene_variant ; 544.0bp to feature; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> C	LOC_Os02g35830.1	downstream_gene_variant ; 4375.0bp to feature; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0221533352	G -> C	LOC_Os02g35840-LOC_Os02g35860	intergenic_region ; MODIFIER	silent_mutation	Average:50.258; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221533352	NA	6.37E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	4.11E-06	mr1283	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	3.22E-06	mr1293	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	5.18E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	6.84E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	7.36E-08	mr1461	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	4.92E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	1.61E-09	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	2.06E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	5.88E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	1.83E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	1.69E-07	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	2.13E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	9.33E-06	mr1863	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	1.95E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	3.32E-06	3.32E-06	mr1918	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221533352	NA	1.59E-06	mr1911_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251