Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0221507264:

Variant ID: vg0221507264 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21507264
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAAGGGAAAGTGCAAAAGGTGCTCGAGATGTCAAGGATTTGGGAATCAAGCTAGAACTTGCAAGGAACCTGAGTGCGTAGACCTATCTGATCTTGCAT[C/A]
TGCTCCAGCACCCCCCCCCCCAAAAAAAAGAAAGAAAAGGTCTAGTTTTCCTGCTTCTCCTTCTGATATCTTAATCTGCATTTTTTGTACTGCTAACAAT

Reverse complement sequence

ATTGTTAGCAGTACAAAAAATGCAGATTAAGATATCAGAAGGAGAAGCAGGAAAACTAGACCTTTTCTTTCTTTTTTTTGGGGGGGGGGGTGCTGGAGCA[G/T]
ATGCAAGATCAGATAGGTCTACGCACTCAGGTTCCTTGCAAGTTCTAGCTTGATTCCCAAATCCTTGACATCTCGAGCACCTTTTGCACTTTCCCTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	2.40%	2.77%	0.00%	NA
All Indica	2759	98.00%	0.30%	1.63%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	31.60%	36.80%	31.60%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	96.80%	0.40%	2.80%	0.00%	NA
Indica III	913	98.90%	0.10%	0.99%	0.00%	NA
Indica Intermediate	786	96.40%	0.80%	2.80%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221507264	C -> A	LOC_Os02g35800.1	upstream_gene_variant ; 1399.0bp to feature; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456	N	N	N	N
vg0221507264	C -> A	LOC_Os02g35780.1	downstream_gene_variant ; 1775.0bp to feature; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456	N	N	N	N
vg0221507264	C -> A	LOC_Os02g35790.1	intron_variant ; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221507264	NA	1.96E-16	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	NA	1.03E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	3.29E-06	4.43E-21	mr1117_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	NA	5.04E-19	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	NA	5.73E-23	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	1.37E-06	1.64E-24	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	NA	1.09E-18	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	3.93E-06	2.68E-23	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264	NA	5.74E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251