\
| Variant ID: vg0221507264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21507264 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAAAGGGAAAGTGCAAAAGGTGCTCGAGATGTCAAGGATTTGGGAATCAAGCTAGAACTTGCAAGGAACCTGAGTGCGTAGACCTATCTGATCTTGCAT[C/A]
TGCTCCAGCACCCCCCCCCCCAAAAAAAAGAAAGAAAAGGTCTAGTTTTCCTGCTTCTCCTTCTGATATCTTAATCTGCATTTTTTGTACTGCTAACAAT
ATTGTTAGCAGTACAAAAAATGCAGATTAAGATATCAGAAGGAGAAGCAGGAAAACTAGACCTTTTCTTTCTTTTTTTTGGGGGGGGGGGTGCTGGAGCA[G/T]
ATGCAAGATCAGATAGGTCTACGCACTCAGGTTCCTTGCAAGTTCTAGCTTGATTCCCAAATCCTTGACATCTCGAGCACCTTTTGCACTTTCCCTTTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 2.40% | 2.77% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 0.30% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 31.60% | 36.80% | 31.60% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 0.40% | 2.80% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 0.80% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221507264 | C -> A | LOC_Os02g35800.1 | upstream_gene_variant ; 1399.0bp to feature; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0221507264 | C -> A | LOC_Os02g35780.1 | downstream_gene_variant ; 1775.0bp to feature; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0221507264 | C -> A | LOC_Os02g35790.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221507264 | NA | 1.96E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | NA | 1.03E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | 3.29E-06 | 4.43E-21 | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | NA | 5.04E-19 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | NA | 5.73E-23 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | 1.37E-06 | 1.64E-24 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | NA | 1.09E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | 3.93E-06 | 2.68E-23 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221507264 | NA | 5.74E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |