\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221507264:

Variant ID: vg0221507264 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21507264
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAAGGGAAAGTGCAAAAGGTGCTCGAGATGTCAAGGATTTGGGAATCAAGCTAGAACTTGCAAGGAACCTGAGTGCGTAGACCTATCTGATCTTGCAT[C/A]
TGCTCCAGCACCCCCCCCCCCAAAAAAAAGAAAGAAAAGGTCTAGTTTTCCTGCTTCTCCTTCTGATATCTTAATCTGCATTTTTTGTACTGCTAACAAT

Reverse complement sequence

ATTGTTAGCAGTACAAAAAATGCAGATTAAGATATCAGAAGGAGAAGCAGGAAAACTAGACCTTTTCTTTCTTTTTTTTGGGGGGGGGGGTGCTGGAGCA[G/T]
ATGCAAGATCAGATAGGTCTACGCACTCAGGTTCCTTGCAAGTTCTAGCTTGATTCCCAAATCCTTGACATCTCGAGCACCTTTTGCACTTTCCCTTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 2.40% 2.77% 0.00% NA
All Indica  2759 98.00% 0.30% 1.63% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 31.60% 36.80% 31.60% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 96.80% 0.40% 2.80% 0.00% NA
Indica III  913 98.90% 0.10% 0.99% 0.00% NA
Indica Intermediate  786 96.40% 0.80% 2.80% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221507264 C -> A LOC_Os02g35800.1 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0221507264 C -> A LOC_Os02g35780.1 downstream_gene_variant ; 1775.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0221507264 C -> A LOC_Os02g35790.1 intron_variant ; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221507264 NA 1.96E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 NA 1.03E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 3.29E-06 4.43E-21 mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 NA 5.04E-19 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 NA 5.73E-23 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 1.37E-06 1.64E-24 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 NA 1.09E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 3.93E-06 2.68E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221507264 NA 5.74E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251